ID: 1089138507

View in Genome Browser
Species Human (GRCh38)
Location 11:116268291-116268313
Sequence CCTCCTCCAGGCCCTTGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089138497_1089138507 23 Left 1089138497 11:116268245-116268267 CCGGGGTCCTGTTCAGCAACACT No data
Right 1089138507 11:116268291-116268313 CCTCCTCCAGGCCCTTGAGGGGG No data
1089138496_1089138507 24 Left 1089138496 11:116268244-116268266 CCCGGGGTCCTGTTCAGCAACAC No data
Right 1089138507 11:116268291-116268313 CCTCCTCCAGGCCCTTGAGGGGG No data
1089138498_1089138507 16 Left 1089138498 11:116268252-116268274 CCTGTTCAGCAACACTTCTGAGG No data
Right 1089138507 11:116268291-116268313 CCTCCTCCAGGCCCTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089138507 Original CRISPR CCTCCTCCAGGCCCTTGAGG GGG Intergenic
No off target data available for this crispr