ID: 1089140849

View in Genome Browser
Species Human (GRCh38)
Location 11:116282658-116282680
Sequence TGGTAGTGATCATAAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089140848_1089140849 -9 Left 1089140848 11:116282644-116282666 CCTGCGTAAACTAGTGGTAGTGA No data
Right 1089140849 11:116282658-116282680 TGGTAGTGATCATAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089140849 Original CRISPR TGGTAGTGATCATAAGAGAC AGG Intergenic