ID: 1089142889

View in Genome Browser
Species Human (GRCh38)
Location 11:116301637-116301659
Sequence CCTATCAGTTCACCTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089142889_1089142891 2 Left 1089142889 11:116301637-116301659 CCAAAAAAAGGTGAACTGATAGG No data
Right 1089142891 11:116301662-116301684 CATGACCAAGACCATGACCATGG No data
1089142889_1089142892 3 Left 1089142889 11:116301637-116301659 CCAAAAAAAGGTGAACTGATAGG No data
Right 1089142892 11:116301663-116301685 ATGACCAAGACCATGACCATGGG No data
1089142889_1089142896 22 Left 1089142889 11:116301637-116301659 CCAAAAAAAGGTGAACTGATAGG No data
Right 1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089142889 Original CRISPR CCTATCAGTTCACCTTTTTT TGG (reversed) Intergenic
No off target data available for this crispr