ID: 1089142893

View in Genome Browser
Species Human (GRCh38)
Location 11:116301667-116301689
Sequence GTATCCCATGGTCATGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089142893_1089142896 -8 Left 1089142893 11:116301667-116301689 CCAAGACCATGACCATGGGATAC No data
Right 1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089142893 Original CRISPR GTATCCCATGGTCATGGTCT TGG (reversed) Intergenic
No off target data available for this crispr