ID: 1089142896

View in Genome Browser
Species Human (GRCh38)
Location 11:116301682-116301704
Sequence TGGGATACACTGATCTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089142888_1089142896 23 Left 1089142888 11:116301636-116301658 CCCAAAAAAAGGTGAACTGATAG No data
Right 1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG No data
1089142889_1089142896 22 Left 1089142889 11:116301637-116301659 CCAAAAAAAGGTGAACTGATAGG No data
Right 1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG No data
1089142893_1089142896 -8 Left 1089142893 11:116301667-116301689 CCAAGACCATGACCATGGGATAC No data
Right 1089142896 11:116301682-116301704 TGGGATACACTGATCTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089142896 Original CRISPR TGGGATACACTGATCTAACA TGG Intergenic
No off target data available for this crispr