ID: 1089149288

View in Genome Browser
Species Human (GRCh38)
Location 11:116352357-116352379
Sequence GTTTTAAGGGGGATTTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089149278_1089149288 4 Left 1089149278 11:116352330-116352352 CCTGCCAGGGCAGACTGCAGAGG No data
Right 1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG No data
1089149275_1089149288 13 Left 1089149275 11:116352321-116352343 CCGTCCCTTCCTGCCAGGGCAGA No data
Right 1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG No data
1089149272_1089149288 25 Left 1089149272 11:116352309-116352331 CCAGATGGCTTGCCGTCCCTTCC No data
Right 1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG No data
1089149276_1089149288 9 Left 1089149276 11:116352325-116352347 CCCTTCCTGCCAGGGCAGACTGC No data
Right 1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG No data
1089149280_1089149288 0 Left 1089149280 11:116352334-116352356 CCAGGGCAGACTGCAGAGGCCAG No data
Right 1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG No data
1089149277_1089149288 8 Left 1089149277 11:116352326-116352348 CCTTCCTGCCAGGGCAGACTGCA No data
Right 1089149288 11:116352357-116352379 GTTTTAAGGGGGATTTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089149288 Original CRISPR GTTTTAAGGGGGATTTAGGA AGG Intergenic
No off target data available for this crispr