ID: 1089151339

View in Genome Browser
Species Human (GRCh38)
Location 11:116366733-116366755
Sequence AAGTCAGGAGGGTCTTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089151339_1089151346 15 Left 1089151339 11:116366733-116366755 CCAACTCAAGACCCTCCTGACTT No data
Right 1089151346 11:116366771-116366793 CTCTCACCTGCCTGCCTCCCTGG No data
1089151339_1089151350 29 Left 1089151339 11:116366733-116366755 CCAACTCAAGACCCTCCTGACTT No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089151339 Original CRISPR AAGTCAGGAGGGTCTTGAGT TGG (reversed) Intergenic
No off target data available for this crispr