ID: 1089151346

View in Genome Browser
Species Human (GRCh38)
Location 11:116366771-116366793
Sequence CTCTCACCTGCCTGCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089151342_1089151346 3 Left 1089151342 11:116366745-116366767 CCTCCTGACTTGAACCTGGAATA No data
Right 1089151346 11:116366771-116366793 CTCTCACCTGCCTGCCTCCCTGG No data
1089151339_1089151346 15 Left 1089151339 11:116366733-116366755 CCAACTCAAGACCCTCCTGACTT No data
Right 1089151346 11:116366771-116366793 CTCTCACCTGCCTGCCTCCCTGG No data
1089151338_1089151346 22 Left 1089151338 11:116366726-116366748 CCTTCTTCCAACTCAAGACCCTC No data
Right 1089151346 11:116366771-116366793 CTCTCACCTGCCTGCCTCCCTGG No data
1089151343_1089151346 0 Left 1089151343 11:116366748-116366770 CCTGACTTGAACCTGGAATAGTC No data
Right 1089151346 11:116366771-116366793 CTCTCACCTGCCTGCCTCCCTGG No data
1089151341_1089151346 4 Left 1089151341 11:116366744-116366766 CCCTCCTGACTTGAACCTGGAAT No data
Right 1089151346 11:116366771-116366793 CTCTCACCTGCCTGCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089151346 Original CRISPR CTCTCACCTGCCTGCCTCCC TGG Intergenic
No off target data available for this crispr