ID: 1089151350

View in Genome Browser
Species Human (GRCh38)
Location 11:116366785-116366807
Sequence CCTCCCTGGCTATGCATGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089151344_1089151350 3 Left 1089151344 11:116366759-116366781 CCTGGAATAGTCCTCTCACCTGC No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data
1089151341_1089151350 18 Left 1089151341 11:116366744-116366766 CCCTCCTGACTTGAACCTGGAAT No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data
1089151339_1089151350 29 Left 1089151339 11:116366733-116366755 CCAACTCAAGACCCTCCTGACTT No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data
1089151342_1089151350 17 Left 1089151342 11:116366745-116366767 CCTCCTGACTTGAACCTGGAATA No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data
1089151345_1089151350 -8 Left 1089151345 11:116366770-116366792 CCTCTCACCTGCCTGCCTCCCTG No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data
1089151343_1089151350 14 Left 1089151343 11:116366748-116366770 CCTGACTTGAACCTGGAATAGTC No data
Right 1089151350 11:116366785-116366807 CCTCCCTGGCTATGCATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089151350 Original CRISPR CCTCCCTGGCTATGCATGCT TGG Intergenic
No off target data available for this crispr