ID: 1089162812

View in Genome Browser
Species Human (GRCh38)
Location 11:116452564-116452586
Sequence CCACATGCACAGAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089162812_1089162819 0 Left 1089162812 11:116452564-116452586 CCCAGAGCCCTCTGTGCATGTGG No data
Right 1089162819 11:116452587-116452609 CCTGGCATGTCTCACTGCCAAGG No data
1089162812_1089162820 3 Left 1089162812 11:116452564-116452586 CCCAGAGCCCTCTGTGCATGTGG No data
Right 1089162820 11:116452590-116452612 GGCATGTCTCACTGCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089162812 Original CRISPR CCACATGCACAGAGGGCTCT GGG (reversed) Intergenic
No off target data available for this crispr