ID: 1089162812 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:116452564-116452586 |
Sequence | CCACATGCACAGAGGGCTCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1089162812_1089162819 | 0 | Left | 1089162812 | 11:116452564-116452586 | CCCAGAGCCCTCTGTGCATGTGG | No data | ||
Right | 1089162819 | 11:116452587-116452609 | CCTGGCATGTCTCACTGCCAAGG | No data | ||||
1089162812_1089162820 | 3 | Left | 1089162812 | 11:116452564-116452586 | CCCAGAGCCCTCTGTGCATGTGG | No data | ||
Right | 1089162820 | 11:116452590-116452612 | GGCATGTCTCACTGCCAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1089162812 | Original CRISPR | CCACATGCACAGAGGGCTCT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |