ID: 1089163209

View in Genome Browser
Species Human (GRCh38)
Location 11:116455412-116455434
Sequence ATGTCTACACCTCTGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089163203_1089163209 25 Left 1089163203 11:116455364-116455386 CCTCATCCCACTCTTACCTGCTC No data
Right 1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG No data
1089163204_1089163209 19 Left 1089163204 11:116455370-116455392 CCCACTCTTACCTGCTCTGCTTG No data
Right 1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG No data
1089163206_1089163209 9 Left 1089163206 11:116455380-116455402 CCTGCTCTGCTTGATACGACGTC No data
Right 1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG No data
1089163205_1089163209 18 Left 1089163205 11:116455371-116455393 CCACTCTTACCTGCTCTGCTTGA No data
Right 1089163209 11:116455412-116455434 ATGTCTACACCTCTGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089163209 Original CRISPR ATGTCTACACCTCTGCAGGC AGG Intergenic
No off target data available for this crispr