ID: 1089163602

View in Genome Browser
Species Human (GRCh38)
Location 11:116458124-116458146
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089163602_1089163617 18 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163617 11:116458165-116458187 CAAGTGGGAAGGAAGAGGAAAGG No data
1089163602_1089163614 3 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163614 11:116458150-116458172 GGGCTGGGGAAGGGACAAGTGGG No data
1089163602_1089163611 -7 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163611 11:116458140-116458162 TGATGGAGGTGGGCTGGGGAAGG No data
1089163602_1089163613 2 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163613 11:116458149-116458171 TGGGCTGGGGAAGGGACAAGTGG No data
1089163602_1089163619 30 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163619 11:116458177-116458199 AAGAGGAAAGGCAGGCCTGCTGG No data
1089163602_1089163612 -6 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163612 11:116458141-116458163 GATGGAGGTGGGCTGGGGAAGGG No data
1089163602_1089163616 13 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163616 11:116458160-116458182 AGGGACAAGTGGGAAGGAAGAGG No data
1089163602_1089163615 7 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163615 11:116458154-116458176 TGGGGAAGGGACAAGTGGGAAGG No data
1089163602_1089163618 22 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163618 11:116458169-116458191 TGGGAAGGAAGAGGAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089163602 Original CRISPR TCCATCAGTGATGTGTAACG GGG (reversed) Intergenic