ID: 1089163603

View in Genome Browser
Species Human (GRCh38)
Location 11:116458125-116458147
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089163603_1089163615 6 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163615 11:116458154-116458176 TGGGGAAGGGACAAGTGGGAAGG No data
1089163603_1089163617 17 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163617 11:116458165-116458187 CAAGTGGGAAGGAAGAGGAAAGG No data
1089163603_1089163612 -7 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163612 11:116458141-116458163 GATGGAGGTGGGCTGGGGAAGGG No data
1089163603_1089163619 29 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163619 11:116458177-116458199 AAGAGGAAAGGCAGGCCTGCTGG No data
1089163603_1089163613 1 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163613 11:116458149-116458171 TGGGCTGGGGAAGGGACAAGTGG No data
1089163603_1089163616 12 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163616 11:116458160-116458182 AGGGACAAGTGGGAAGGAAGAGG No data
1089163603_1089163611 -8 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163611 11:116458140-116458162 TGATGGAGGTGGGCTGGGGAAGG No data
1089163603_1089163618 21 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163618 11:116458169-116458191 TGGGAAGGAAGAGGAAAGGCAGG No data
1089163603_1089163614 2 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163614 11:116458150-116458172 GGGCTGGGGAAGGGACAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089163603 Original CRISPR CTCCATCAGTGATGTGTAAC GGG (reversed) Intergenic
No off target data available for this crispr