ID: 1089163613

View in Genome Browser
Species Human (GRCh38)
Location 11:116458149-116458171
Sequence TGGGCTGGGGAAGGGACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089163604_1089163613 0 Left 1089163604 11:116458126-116458148 CCGTTACACATCACTGATGGAGG No data
Right 1089163613 11:116458149-116458171 TGGGCTGGGGAAGGGACAAGTGG No data
1089163602_1089163613 2 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163613 11:116458149-116458171 TGGGCTGGGGAAGGGACAAGTGG No data
1089163603_1089163613 1 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163613 11:116458149-116458171 TGGGCTGGGGAAGGGACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089163613 Original CRISPR TGGGCTGGGGAAGGGACAAG TGG Intergenic
No off target data available for this crispr