ID: 1089163618

View in Genome Browser
Species Human (GRCh38)
Location 11:116458169-116458191
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089163603_1089163618 21 Left 1089163603 11:116458125-116458147 CCCGTTACACATCACTGATGGAG No data
Right 1089163618 11:116458169-116458191 TGGGAAGGAAGAGGAAAGGCAGG No data
1089163602_1089163618 22 Left 1089163602 11:116458124-116458146 CCCCGTTACACATCACTGATGGA No data
Right 1089163618 11:116458169-116458191 TGGGAAGGAAGAGGAAAGGCAGG No data
1089163604_1089163618 20 Left 1089163604 11:116458126-116458148 CCGTTACACATCACTGATGGAGG No data
Right 1089163618 11:116458169-116458191 TGGGAAGGAAGAGGAAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089163618 Original CRISPR TGGGAAGGAAGAGGAAAGGC AGG Intergenic