ID: 1089164360

View in Genome Browser
Species Human (GRCh38)
Location 11:116463430-116463452
Sequence ATGATGCTGTGAAGGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089164360_1089164366 -3 Left 1089164360 11:116463430-116463452 CCTTCCCACCTTCACAGCATCAT No data
Right 1089164366 11:116463450-116463472 CATGGTTATAAGCACTCAGAGGG No data
1089164360_1089164365 -4 Left 1089164360 11:116463430-116463452 CCTTCCCACCTTCACAGCATCAT No data
Right 1089164365 11:116463449-116463471 TCATGGTTATAAGCACTCAGAGG No data
1089164360_1089164367 8 Left 1089164360 11:116463430-116463452 CCTTCCCACCTTCACAGCATCAT No data
Right 1089164367 11:116463461-116463483 GCACTCAGAGGGAATGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089164360 Original CRISPR ATGATGCTGTGAAGGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr