ID: 1089164367

View in Genome Browser
Species Human (GRCh38)
Location 11:116463461-116463483
Sequence GCACTCAGAGGGAATGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089164362_1089164367 4 Left 1089164362 11:116463434-116463456 CCCACCTTCACAGCATCATGGTT No data
Right 1089164367 11:116463461-116463483 GCACTCAGAGGGAATGCTCATGG No data
1089164360_1089164367 8 Left 1089164360 11:116463430-116463452 CCTTCCCACCTTCACAGCATCAT No data
Right 1089164367 11:116463461-116463483 GCACTCAGAGGGAATGCTCATGG No data
1089164363_1089164367 3 Left 1089164363 11:116463435-116463457 CCACCTTCACAGCATCATGGTTA No data
Right 1089164367 11:116463461-116463483 GCACTCAGAGGGAATGCTCATGG No data
1089164364_1089164367 0 Left 1089164364 11:116463438-116463460 CCTTCACAGCATCATGGTTATAA No data
Right 1089164367 11:116463461-116463483 GCACTCAGAGGGAATGCTCATGG No data
1089164359_1089164367 12 Left 1089164359 11:116463426-116463448 CCTACCTTCCCACCTTCACAGCA No data
Right 1089164367 11:116463461-116463483 GCACTCAGAGGGAATGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089164367 Original CRISPR GCACTCAGAGGGAATGCTCA TGG Intergenic
No off target data available for this crispr