ID: 1089165418

View in Genome Browser
Species Human (GRCh38)
Location 11:116472243-116472265
Sequence CTCTGGACACCAAAGCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089165415_1089165418 3 Left 1089165415 11:116472217-116472239 CCCACATAATGAAACTCATATAA No data
Right 1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG No data
1089165414_1089165418 24 Left 1089165414 11:116472196-116472218 CCGTTGATTCAATCAATCATGCC No data
Right 1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG No data
1089165416_1089165418 2 Left 1089165416 11:116472218-116472240 CCACATAATGAAACTCATATAAA No data
Right 1089165418 11:116472243-116472265 CTCTGGACACCAAAGCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089165418 Original CRISPR CTCTGGACACCAAAGCTCAG TGG Intergenic
No off target data available for this crispr