ID: 1089169194

View in Genome Browser
Species Human (GRCh38)
Location 11:116500502-116500524
Sequence CTGGGCAACTCGAAGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089169194_1089169203 13 Left 1089169194 11:116500502-116500524 CCGGCCACCTTCGAGTTGCCCAG No data
Right 1089169203 11:116500538-116500560 TTACCCGCAGAAGTCGGCGGTGG 0: 1
1: 0
2: 0
3: 1
4: 32
1089169194_1089169201 10 Left 1089169194 11:116500502-116500524 CCGGCCACCTTCGAGTTGCCCAG No data
Right 1089169201 11:116500535-116500557 CCCTTACCCGCAGAAGTCGGCGG 0: 1
1: 0
2: 1
3: 9
4: 65
1089169194_1089169199 7 Left 1089169194 11:116500502-116500524 CCGGCCACCTTCGAGTTGCCCAG No data
Right 1089169199 11:116500532-116500554 TTTCCCTTACCCGCAGAAGTCGG 0: 1
1: 0
2: 1
3: 12
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089169194 Original CRISPR CTGGGCAACTCGAAGGTGGC CGG (reversed) Intergenic
No off target data available for this crispr