ID: 1089171377

View in Genome Browser
Species Human (GRCh38)
Location 11:116513936-116513958
Sequence GGCAATGATCCGGCTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089171370_1089171377 2 Left 1089171370 11:116513911-116513933 CCTGGTGGCTCCCTCTAGATGGC No data
Right 1089171377 11:116513936-116513958 GGCAATGATCCGGCTGAGGTTGG No data
1089171368_1089171377 13 Left 1089171368 11:116513900-116513922 CCACTGGATGACCTGGTGGCTCC No data
Right 1089171377 11:116513936-116513958 GGCAATGATCCGGCTGAGGTTGG No data
1089171372_1089171377 -8 Left 1089171372 11:116513921-116513943 CCCTCTAGATGGCCTGGCAATGA No data
Right 1089171377 11:116513936-116513958 GGCAATGATCCGGCTGAGGTTGG No data
1089171373_1089171377 -9 Left 1089171373 11:116513922-116513944 CCTCTAGATGGCCTGGCAATGAT No data
Right 1089171377 11:116513936-116513958 GGCAATGATCCGGCTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089171377 Original CRISPR GGCAATGATCCGGCTGAGGT TGG Intergenic
No off target data available for this crispr