ID: 1089179958

View in Genome Browser
Species Human (GRCh38)
Location 11:116576662-116576684
Sequence ACCACAAATGTCTCCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089179958_1089179966 25 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179966 11:116576710-116576732 AAAGAGAGGAGGAGGTGCCAGGG No data
1089179958_1089179967 26 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179967 11:116576711-116576733 AAGAGAGGAGGAGGTGCCAGGGG No data
1089179958_1089179964 17 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179964 11:116576702-116576724 AGATTAGGAAAGAGAGGAGGAGG No data
1089179958_1089179960 2 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179960 11:116576687-116576709 AATTGCACCAATGCAAGATTAGG No data
1089179958_1089179968 27 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179968 11:116576712-116576734 AGAGAGGAGGAGGTGCCAGGGGG No data
1089179958_1089179962 11 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179962 11:116576696-116576718 AATGCAAGATTAGGAAAGAGAGG No data
1089179958_1089179965 24 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179965 11:116576709-116576731 GAAAGAGAGGAGGAGGTGCCAGG No data
1089179958_1089179963 14 Left 1089179958 11:116576662-116576684 CCCACTCTGGAGACATTTGTGGT No data
Right 1089179963 11:116576699-116576721 GCAAGATTAGGAAAGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089179958 Original CRISPR ACCACAAATGTCTCCAGAGT GGG (reversed) Intergenic
No off target data available for this crispr