ID: 1089180858

View in Genome Browser
Species Human (GRCh38)
Location 11:116581927-116581949
Sequence CTGAGCCTCAGTTGCTCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089180858_1089180860 -4 Left 1089180858 11:116581927-116581949 CCTAATGAGCAACTGAGGCTCAG No data
Right 1089180860 11:116581946-116581968 TCAGAAATGTTAGCAGGACTAGG No data
1089180858_1089180863 9 Left 1089180858 11:116581927-116581949 CCTAATGAGCAACTGAGGCTCAG No data
Right 1089180863 11:116581959-116581981 CAGGACTAGGGCTAGAGCCTGGG No data
1089180858_1089180861 -3 Left 1089180858 11:116581927-116581949 CCTAATGAGCAACTGAGGCTCAG No data
Right 1089180861 11:116581947-116581969 CAGAAATGTTAGCAGGACTAGGG No data
1089180858_1089180859 -10 Left 1089180858 11:116581927-116581949 CCTAATGAGCAACTGAGGCTCAG No data
Right 1089180859 11:116581940-116581962 TGAGGCTCAGAAATGTTAGCAGG No data
1089180858_1089180862 8 Left 1089180858 11:116581927-116581949 CCTAATGAGCAACTGAGGCTCAG No data
Right 1089180862 11:116581958-116581980 GCAGGACTAGGGCTAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089180858 Original CRISPR CTGAGCCTCAGTTGCTCATT AGG (reversed) Intergenic
No off target data available for this crispr