ID: 1089180889

View in Genome Browser
Species Human (GRCh38)
Location 11:116582147-116582169
Sequence TGTTGTCTTTAGAAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089180885_1089180889 -9 Left 1089180885 11:116582133-116582155 CCAGGGACATTTCCTGTTGTCTT No data
Right 1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG No data
1089180883_1089180889 7 Left 1089180883 11:116582117-116582139 CCAACAACAAGCATACCCAGGGA No data
Right 1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG No data
1089180884_1089180889 -8 Left 1089180884 11:116582132-116582154 CCCAGGGACATTTCCTGTTGTCT No data
Right 1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG No data
1089180880_1089180889 26 Left 1089180880 11:116582098-116582120 CCTGAAATTGGGCATTTATCCAA No data
Right 1089180889 11:116582147-116582169 TGTTGTCTTTAGAAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089180889 Original CRISPR TGTTGTCTTTAGAAGCTGGT GGG Intergenic
No off target data available for this crispr