ID: 1089181464

View in Genome Browser
Species Human (GRCh38)
Location 11:116586068-116586090
Sequence TCATCTTTGTGTACGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089181464_1089181467 4 Left 1089181464 11:116586068-116586090 CCCTCTTACGTACACAAAGATGA No data
Right 1089181467 11:116586095-116586117 AGAAGGCGTTCATTGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089181464 Original CRISPR TCATCTTTGTGTACGTAAGA GGG (reversed) Intergenic
No off target data available for this crispr