ID: 1089184891

View in Genome Browser
Species Human (GRCh38)
Location 11:116608129-116608151
Sequence CACTAGAGTCTGCAAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089184891_1089184894 5 Left 1089184891 11:116608129-116608151 CCTTGGGTTTGCAGACTCTAGTG No data
Right 1089184894 11:116608157-116608179 GTAAGGTCAGAGCTGGCTAAAGG No data
1089184891_1089184893 -2 Left 1089184891 11:116608129-116608151 CCTTGGGTTTGCAGACTCTAGTG No data
Right 1089184893 11:116608150-116608172 TGACAGAGTAAGGTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089184891 Original CRISPR CACTAGAGTCTGCAAACCCA AGG (reversed) Intergenic
No off target data available for this crispr