ID: 1089187087

View in Genome Browser
Species Human (GRCh38)
Location 11:116625442-116625464
Sequence CTGTGGAAGGATAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089187079_1089187087 19 Left 1089187079 11:116625400-116625422 CCTTCTCCCTAAATCATGAGGAC No data
Right 1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG No data
1089187076_1089187087 23 Left 1089187076 11:116625396-116625418 CCCTCCTTCTCCCTAAATCATGA No data
Right 1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG No data
1089187077_1089187087 22 Left 1089187077 11:116625397-116625419 CCTCCTTCTCCCTAAATCATGAG No data
Right 1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG No data
1089187080_1089187087 13 Left 1089187080 11:116625406-116625428 CCCTAAATCATGAGGACAAGAGA No data
Right 1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG No data
1089187081_1089187087 12 Left 1089187081 11:116625407-116625429 CCTAAATCATGAGGACAAGAGAC No data
Right 1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG No data
1089187075_1089187087 30 Left 1089187075 11:116625389-116625411 CCTTCTTCCCTCCTTCTCCCTAA No data
Right 1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089187087 Original CRISPR CTGTGGAAGGATAAGGTGGA AGG Intergenic
No off target data available for this crispr