ID: 1089188093

View in Genome Browser
Species Human (GRCh38)
Location 11:116634670-116634692
Sequence AGTTTGTTATAGCAGTTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089188093_1089188095 30 Left 1089188093 11:116634670-116634692 CCATGTAACTGCTATAACAAACT No data
Right 1089188095 11:116634723-116634745 GTTATTTCCCACAGTTCCAGAGG No data
1089188093_1089188094 8 Left 1089188093 11:116634670-116634692 CCATGTAACTGCTATAACAAACT No data
Right 1089188094 11:116634701-116634723 CTACTAGATGACTTAAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089188093 Original CRISPR AGTTTGTTATAGCAGTTACA TGG (reversed) Intergenic
No off target data available for this crispr