ID: 1089190143

View in Genome Browser
Species Human (GRCh38)
Location 11:116647833-116647855
Sequence TAGTGTGTGCAGAGGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089190136_1089190143 10 Left 1089190136 11:116647800-116647822 CCTATTAAGGCTGCCGTAGCACC No data
Right 1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG No data
1089190135_1089190143 11 Left 1089190135 11:116647799-116647821 CCCTATTAAGGCTGCCGTAGCAC No data
Right 1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG No data
1089190137_1089190143 -3 Left 1089190137 11:116647813-116647835 CCGTAGCACCGTCTCTGCCCTAG No data
Right 1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG No data
1089190134_1089190143 12 Left 1089190134 11:116647798-116647820 CCCCTATTAAGGCTGCCGTAGCA No data
Right 1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089190143 Original CRISPR TAGTGTGTGCAGAGGGAAAA CGG Intergenic
No off target data available for this crispr