ID: 1089192091

View in Genome Browser
Species Human (GRCh38)
Location 11:116660604-116660626
Sequence CCTGCACCCAGCCAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089192079_1089192091 26 Left 1089192079 11:116660555-116660577 CCTACAGTGGGATTCTCAGACTG No data
Right 1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG No data
1089192082_1089192091 3 Left 1089192082 11:116660578-116660600 CCTTCCCACTGCAAGGGAGTCCA No data
Right 1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG No data
1089192084_1089192091 -2 Left 1089192084 11:116660583-116660605 CCACTGCAAGGGAGTCCAGAGCC No data
Right 1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG No data
1089192078_1089192091 29 Left 1089192078 11:116660552-116660574 CCACCTACAGTGGGATTCTCAGA No data
Right 1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG No data
1089192083_1089192091 -1 Left 1089192083 11:116660582-116660604 CCCACTGCAAGGGAGTCCAGAGC No data
Right 1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089192091 Original CRISPR CCTGCACCCAGCCAGGGGGA TGG Intergenic
No off target data available for this crispr