ID: 1089193913

View in Genome Browser
Species Human (GRCh38)
Location 11:116679991-116680013
Sequence GTCTCAAGGAAAAGAGACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089193913_1089193916 -4 Left 1089193913 11:116679991-116680013 CCTTAGTCTCTTTTCCTTGAGAC No data
Right 1089193916 11:116680010-116680032 AGACATCTGTCCAATTTAAAGGG No data
1089193913_1089193915 -5 Left 1089193913 11:116679991-116680013 CCTTAGTCTCTTTTCCTTGAGAC No data
Right 1089193915 11:116680009-116680031 GAGACATCTGTCCAATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089193913 Original CRISPR GTCTCAAGGAAAAGAGACTA AGG (reversed) Intergenic
No off target data available for this crispr