ID: 1089193930

View in Genome Browser
Species Human (GRCh38)
Location 11:116680201-116680223
Sequence CTGGAGGCCTTGAAATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089193930_1089193935 22 Left 1089193930 11:116680201-116680223 CCCAAATATTTCAAGGCCTCCAG No data
Right 1089193935 11:116680246-116680268 TTTCATTTCTGCTTGCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089193930 Original CRISPR CTGGAGGCCTTGAAATATTT GGG (reversed) Intergenic
No off target data available for this crispr