ID: 1089194328

View in Genome Browser
Species Human (GRCh38)
Location 11:116684385-116684407
Sequence TAAGTATGATGTTAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089194328_1089194331 12 Left 1089194328 11:116684385-116684407 CCCTGCAGCTAACATCATACTTA No data
Right 1089194331 11:116684420-116684442 TGAATGCTTTTCACTTAAATTGG No data
1089194328_1089194333 25 Left 1089194328 11:116684385-116684407 CCCTGCAGCTAACATCATACTTA No data
Right 1089194333 11:116684433-116684455 CTTAAATTGGGAACAAATTAAGG No data
1089194328_1089194332 13 Left 1089194328 11:116684385-116684407 CCCTGCAGCTAACATCATACTTA No data
Right 1089194332 11:116684421-116684443 GAATGCTTTTCACTTAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089194328 Original CRISPR TAAGTATGATGTTAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr