ID: 1089195829

View in Genome Browser
Species Human (GRCh38)
Location 11:116693537-116693559
Sequence ACCAAATACTTCTCCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089195829_1089195838 9 Left 1089195829 11:116693537-116693559 CCCTGCCTGGAGAAGTATTTGGT No data
Right 1089195838 11:116693569-116693591 GGGCCAAAGCAGGGCCAGGGTGG No data
1089195829_1089195837 6 Left 1089195829 11:116693537-116693559 CCCTGCCTGGAGAAGTATTTGGT No data
Right 1089195837 11:116693566-116693588 AGTGGGCCAAAGCAGGGCCAGGG No data
1089195829_1089195840 21 Left 1089195829 11:116693537-116693559 CCCTGCCTGGAGAAGTATTTGGT No data
Right 1089195840 11:116693581-116693603 GGCCAGGGTGGTTCCTGTTCTGG No data
1089195829_1089195836 5 Left 1089195829 11:116693537-116693559 CCCTGCCTGGAGAAGTATTTGGT No data
Right 1089195836 11:116693565-116693587 TAGTGGGCCAAAGCAGGGCCAGG No data
1089195829_1089195834 -1 Left 1089195829 11:116693537-116693559 CCCTGCCTGGAGAAGTATTTGGT No data
Right 1089195834 11:116693559-116693581 TCAGTCTAGTGGGCCAAAGCAGG No data
1089195829_1089195835 0 Left 1089195829 11:116693537-116693559 CCCTGCCTGGAGAAGTATTTGGT No data
Right 1089195835 11:116693560-116693582 CAGTCTAGTGGGCCAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089195829 Original CRISPR ACCAAATACTTCTCCAGGCA GGG (reversed) Intergenic
No off target data available for this crispr