ID: 1089195987

View in Genome Browser
Species Human (GRCh38)
Location 11:116694374-116694396
Sequence GAGGAGAAGATGGCCCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089195987_1089195992 -2 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089195992 11:116694395-116694417 TCATCTATGCCCCACCAAGAGGG No data
1089195987_1089195999 25 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089195999 11:116694422-116694444 TCCAAGAGGGCAGAGCCAAGAGG No data
1089195987_1089196001 26 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195987_1089195991 -3 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089195991 11:116694394-116694416 CTCATCTATGCCCCACCAAGAGG No data
1089195987_1089195996 11 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089195996 11:116694408-116694430 ACCAAGAGGGCAGCTCCAAGAGG No data
1089195987_1089195998 12 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089195998 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089195987 Original CRISPR GAGGAGAAGATGGCCCAGGT AGG (reversed) Intergenic
No off target data available for this crispr