ID: 1089195989

View in Genome Browser
Species Human (GRCh38)
Location 11:116694384-116694406
Sequence GGGCATAGATGAGGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089195989_1089195996 1 Left 1089195989 11:116694384-116694406 CCATCTTCTCCTCATCTATGCCC No data
Right 1089195996 11:116694408-116694430 ACCAAGAGGGCAGCTCCAAGAGG No data
1089195989_1089195998 2 Left 1089195989 11:116694384-116694406 CCATCTTCTCCTCATCTATGCCC No data
Right 1089195998 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data
1089195989_1089196003 30 Left 1089195989 11:116694384-116694406 CCATCTTCTCCTCATCTATGCCC No data
Right 1089196003 11:116694437-116694459 CCAAGAGGGCAACTCCTACCTGG No data
1089195989_1089196001 16 Left 1089195989 11:116694384-116694406 CCATCTTCTCCTCATCTATGCCC No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195989_1089195999 15 Left 1089195989 11:116694384-116694406 CCATCTTCTCCTCATCTATGCCC No data
Right 1089195999 11:116694422-116694444 TCCAAGAGGGCAGAGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089195989 Original CRISPR GGGCATAGATGAGGAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr