ID: 1089195997

View in Genome Browser
Species Human (GRCh38)
Location 11:116694409-116694431
Sequence CCCTCTTGGAGCTGCCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089195997_1089196001 -9 Left 1089195997 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195997_1089196003 5 Left 1089195997 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data
Right 1089196003 11:116694437-116694459 CCAAGAGGGCAACTCCTACCTGG No data
1089195997_1089196004 6 Left 1089195997 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data
Right 1089196004 11:116694438-116694460 CAAGAGGGCAACTCCTACCTGGG No data
1089195997_1089195999 -10 Left 1089195997 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data
Right 1089195999 11:116694422-116694444 TCCAAGAGGGCAGAGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089195997 Original CRISPR CCCTCTTGGAGCTGCCCTCT TGG (reversed) Intergenic
No off target data available for this crispr