ID: 1089196001

View in Genome Browser
Species Human (GRCh38)
Location 11:116694423-116694445
Sequence CCAAGAGGGCAGAGCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089195994_1089196001 -5 Left 1089195994 11:116694405-116694427 CCCACCAAGAGGGCAGCTCCAAG No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195990_1089196001 7 Left 1089195990 11:116694393-116694415 CCTCATCTATGCCCCACCAAGAG No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195997_1089196001 -9 Left 1089195997 11:116694409-116694431 CCAAGAGGGCAGCTCCAAGAGGG No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195988_1089196001 22 Left 1089195988 11:116694378-116694400 CCTGGGCCATCTTCTCCTCATCT No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195995_1089196001 -6 Left 1089195995 11:116694406-116694428 CCACCAAGAGGGCAGCTCCAAGA No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195993_1089196001 -4 Left 1089195993 11:116694404-116694426 CCCCACCAAGAGGGCAGCTCCAA No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195987_1089196001 26 Left 1089195987 11:116694374-116694396 CCTACCTGGGCCATCTTCTCCTC No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data
1089195989_1089196001 16 Left 1089195989 11:116694384-116694406 CCATCTTCTCCTCATCTATGCCC No data
Right 1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089196001 Original CRISPR CCAAGAGGGCAGAGCCAAGA GGG Intergenic
No off target data available for this crispr