ID: 1089197865

View in Genome Browser
Species Human (GRCh38)
Location 11:116705503-116705525
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089197865_1089197871 28 Left 1089197865 11:116705503-116705525 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089197865 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr