ID: 1089197866

View in Genome Browser
Species Human (GRCh38)
Location 11:116705504-116705526
Sequence TGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 960678
Summary {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089197866_1089197871 27 Left 1089197866 11:116705504-116705526 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089197866 Original CRISPR TGCCTGTAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr