ID: 1089197868

View in Genome Browser
Species Human (GRCh38)
Location 11:116705539-116705561
Sequence ACATTAAGAAGTGATCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089197868_1089197871 -8 Left 1089197868 11:116705539-116705561 CCCAGCCGATCACTTCTTAATGT No data
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089197868 Original CRISPR ACATTAAGAAGTGATCGGCT GGG (reversed) Intergenic
No off target data available for this crispr