ID: 1089197869

View in Genome Browser
Species Human (GRCh38)
Location 11:116705540-116705562
Sequence CACATTAAGAAGTGATCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089197869_1089197871 -9 Left 1089197869 11:116705540-116705562 CCAGCCGATCACTTCTTAATGTG No data
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089197869 Original CRISPR CACATTAAGAAGTGATCGGC TGG (reversed) Intergenic
No off target data available for this crispr