ID: 1089197871

View in Genome Browser
Species Human (GRCh38)
Location 11:116705554-116705576
Sequence CTTAATGTGCAGAAATTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089197868_1089197871 -8 Left 1089197868 11:116705539-116705561 CCCAGCCGATCACTTCTTAATGT No data
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data
1089197865_1089197871 28 Left 1089197865 11:116705503-116705525 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data
1089197867_1089197871 0 Left 1089197867 11:116705531-116705553 CCACTGTGCCCAGCCGATCACTT No data
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data
1089197866_1089197871 27 Left 1089197866 11:116705504-116705526 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data
1089197869_1089197871 -9 Left 1089197869 11:116705540-116705562 CCAGCCGATCACTTCTTAATGTG No data
Right 1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089197871 Original CRISPR CTTAATGTGCAGAAATTGAA AGG Intergenic
No off target data available for this crispr