ID: 1089198757

View in Genome Browser
Species Human (GRCh38)
Location 11:116710844-116710866
Sequence GAGCTGTGCCAGAGGAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089198753_1089198757 13 Left 1089198753 11:116710808-116710830 CCTGTGGAGCTGCTGCAAACAGT No data
Right 1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG No data
1089198752_1089198757 17 Left 1089198752 11:116710804-116710826 CCTACCTGTGGAGCTGCTGCAAA No data
Right 1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG No data
1089198751_1089198757 23 Left 1089198751 11:116710798-116710820 CCTGGACCTACCTGTGGAGCTGC No data
Right 1089198757 11:116710844-116710866 GAGCTGTGCCAGAGGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089198757 Original CRISPR GAGCTGTGCCAGAGGAGAAA TGG Intergenic
No off target data available for this crispr