ID: 1089200144

View in Genome Browser
Species Human (GRCh38)
Location 11:116719803-116719825
Sequence TATTGCGAGCAGGCCCGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089200144_1089200148 28 Left 1089200144 11:116719803-116719825 CCCCATCGGGCCTGCTCGCAATA No data
Right 1089200148 11:116719854-116719876 TGAACACAATCCACCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089200144 Original CRISPR TATTGCGAGCAGGCCCGATG GGG (reversed) Intergenic
No off target data available for this crispr