ID: 1089204598

View in Genome Browser
Species Human (GRCh38)
Location 11:116749471-116749493
Sequence GTTAACTACAGCACTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089204598 Original CRISPR GTTAACTACAGCACTGGGGA TGG Intronic
904607324 1:31704924-31704946 CTTTACACCAGCACTGGGGAGGG + Intergenic
904745269 1:32706882-32706904 ATTAACTCCGGGACTGGGGATGG + Intergenic
904892964 1:33793156-33793178 GATAACCACAGCACTGGGGTGGG + Intronic
906492061 1:46276415-46276437 GTTAATCCCAGCACTTGGGAAGG - Intronic
909745759 1:79095520-79095542 GTAAACGACAGCAGTAGGGATGG - Intergenic
911037667 1:93567634-93567656 GTTATCTGCAGCACTGTGGATGG - Intronic
917504817 1:175618090-175618112 GATAACTACAGTATTGGGGCAGG + Intronic
921635658 1:217489191-217489213 GTTAATTCCAGCACTTTGGAAGG - Intronic
922365603 1:224860589-224860611 GCTGACTGCTGCACTGGGGATGG + Intergenic
924347284 1:243084413-243084435 GTTTACTAGAGTACTGGGCATGG + Intergenic
1063584196 10:7336531-7336553 TGTAACTCCAGCACTTGGGAAGG + Intronic
1064021068 10:11809577-11809599 GTTAACTCCAGCACTTAGGGAGG - Intergenic
1065981669 10:30903581-30903603 GATCTCTACAGCACTGGGGGAGG + Intronic
1070823186 10:79375197-79375219 GTTAACTACTGCTCTGGTCATGG - Intergenic
1071575221 10:86720498-86720520 GTTAACTTCAGAGCTGGGAAGGG - Intronic
1073009425 10:100347938-100347960 GTGAACTACGGCGCTGCGGAAGG + Intronic
1074961229 10:118447848-118447870 GATAACCACAGGACAGGGGAGGG - Intergenic
1076084954 10:127619187-127619209 AATATCTACAGCACTGGGAATGG + Intergenic
1076661506 10:132058673-132058695 GTTACCCAAAGCAGTGGGGAGGG + Intergenic
1079467640 11:20746892-20746914 GTTAACTTCAGCCATGGGAATGG - Intronic
1083911548 11:65712904-65712926 GTTGACTGTAGCAGTGGGGATGG - Exonic
1088929967 11:114341521-114341543 CTTACCTACAGCAATGGGAAAGG - Intergenic
1089204598 11:116749471-116749493 GTTAACTACAGCACTGGGGATGG + Intronic
1091788021 12:3254771-3254793 TATAAGGACAGCACTGGGGAAGG - Intronic
1091980396 12:4859855-4859877 GTCAGCTCCAGCACTGGAGAAGG - Intergenic
1095300369 12:40577714-40577736 AGTAACTCCAGCACTGGAGAAGG - Intergenic
1095350278 12:41202165-41202187 GCTTCCTAGAGCACTGGGGATGG + Intronic
1095833257 12:46610035-46610057 GTTAACTGCAGCTCTGGGGCAGG - Intergenic
1098608590 12:72425823-72425845 GTTAACTACAACACTGAGTATGG - Intronic
1098680027 12:73342004-73342026 ATAAGCTACAGCACTGGGGAAGG - Intergenic
1099832029 12:87856398-87856420 GTTAATTCCAGCACTTTGGAAGG - Intergenic
1101311870 12:103588017-103588039 TTTTACTACAGCTCTGTGGAAGG - Intronic
1102142929 12:110631318-110631340 GTAAACTACAGCTCTAGGGCTGG - Intronic
1107170609 13:37338471-37338493 GTGAACCAAAGCACTGGGTAGGG + Intergenic
1108712133 13:53043914-53043936 GTTAAGTACAGCACAGAGGTGGG + Intronic
1112370731 13:98791144-98791166 GTTACCTACAGCAAGGGAGAGGG - Intergenic
1114155750 14:20101047-20101069 GCTAACTTCAGGACTGGGGTGGG - Intergenic
1116622677 14:47226031-47226053 GTTAACTCCAGCCCTTGGGGAGG + Intronic
1118421973 14:65616200-65616222 TTTGACTACAGGTCTGGGGAAGG + Exonic
1118699462 14:68419045-68419067 ACTGAATACAGCACTGGGGATGG - Intronic
1119619731 14:76123232-76123254 GCTAACTGCAGCACACGGGAAGG + Intergenic
1119740856 14:77012891-77012913 GTCAACAGCAGCACTGGCGATGG - Intergenic
1121029866 14:90649076-90649098 GTTAACCACAGCACCGTGAAAGG + Intronic
1124549528 15:30666095-30666117 GTATACTACATCACTGGCGATGG + Intronic
1125097939 15:35876201-35876223 CTTACCAACAGCATTGGGGAGGG - Intergenic
1126446322 15:48748944-48748966 GCTGACTCCAGTACTGGGGAGGG + Intronic
1127803134 15:62494610-62494632 TTCAACTAAAGCACGGGGGAGGG - Intronic
1129006401 15:72376949-72376971 CTGAACTACAGAAGTGGGGAAGG + Intergenic
1129162840 15:73756483-73756505 GTAGACTAAAGCACTAGGGAAGG - Intergenic
1130192599 15:81750782-81750804 GGTAACAGCAGCACTGCGGAGGG - Intergenic
1132257061 15:100384856-100384878 GTAAACTAAAGCCCTGAGGACGG - Intergenic
1133339956 16:5029665-5029687 GTTAATTCCAGCACTTTGGAAGG + Intronic
1133368838 16:5232705-5232727 GTGCAAGACAGCACTGGGGAAGG - Intergenic
1134084826 16:11349222-11349244 GTTGACTGCAGCAGTGGGGTGGG + Intronic
1137809990 16:51343504-51343526 GTTGATTTCAGCACTGGGGCAGG + Intergenic
1138213372 16:55181521-55181543 TTACACTAGAGCACTGGGGATGG - Intergenic
1139454387 16:67060808-67060830 GTTAATTCCAGCACTGTGGGAGG - Intronic
1139758125 16:69161917-69161939 TGTAACTACAGCACTTCGGAAGG - Intronic
1142075123 16:88113566-88113588 TTTACCTCCAGCCCTGGGGAAGG + Intronic
1143048825 17:4105331-4105353 ATTACCTACAGAACTGGGAAAGG - Intronic
1147341589 17:39755857-39755879 ATAAACCACAGCACTGGGGGTGG - Intergenic
1151295032 17:73178929-73178951 TTTAACTTCAGCACTTTGGAAGG + Intergenic
1151894688 17:76972124-76972146 GTTACCTGCAGCCCAGGGGAGGG + Intergenic
1156301173 18:35837470-35837492 GTTAGCTGTTGCACTGGGGAAGG - Intergenic
1159983530 18:74814379-74814401 TGTAACTACAGCACTGTGGGAGG - Intronic
1161043692 19:2123325-2123347 GAAAATGACAGCACTGGGGAGGG + Intronic
1161322800 19:3649076-3649098 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322813 19:3649126-3649148 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322826 19:3649176-3649198 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322839 19:3649226-3649248 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322852 19:3649276-3649298 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322865 19:3649326-3649348 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322878 19:3649376-3649398 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322891 19:3649426-3649448 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322904 19:3649476-3649498 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322917 19:3649526-3649548 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322930 19:3649576-3649598 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322943 19:3649626-3649648 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322956 19:3649676-3649698 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322969 19:3649726-3649748 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322982 19:3649776-3649798 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1161322995 19:3649826-3649848 GTTAACTCCCGCGCTGGGCAGGG - Intronic
1162688385 19:12407374-12407396 GTTAACTTCAGCCCAGGAGATGG + Intronic
1165728940 19:38131885-38131907 GTTAACTCCAGCACTTTGGGAGG - Intronic
1167064026 19:47170761-47170783 TTTAACTCCAGCACTTTGGAAGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168318887 19:55497014-55497036 GTTAATTCCAGCACTGTGGGAGG - Intronic
926984324 2:18605338-18605360 CTTAAGCACAGTACTGGGGAAGG - Intergenic
927922612 2:26985073-26985095 GTTTACTGCAGCATTTGGGAAGG + Intronic
928091967 2:28380277-28380299 CTTAACAACAGCGCTAGGGATGG - Intergenic
936727356 2:115335836-115335858 TTAAACTACAGCCCTGGGAATGG + Intronic
938212616 2:129481346-129481368 GAAAACTTCAGCACTGGAGATGG - Intergenic
938660885 2:133485990-133486012 ATTAACTACATGACTGGAGAGGG - Intronic
940837321 2:158537735-158537757 GATAAATACAGCGCTGGGCATGG + Intronic
941368969 2:164640355-164640377 GGTAACTACTACAGTGGGGAGGG - Intergenic
942811083 2:180002017-180002039 GTTAATTAAAGCTATGGGGATGG - Intronic
947031702 2:225803850-225803872 CTAAAGTAAAGCACTGGGGAGGG + Intergenic
947649209 2:231770559-231770581 GTTAATTCCAGCACTTGGGGAGG + Intronic
1169922489 20:10750056-10750078 GTTAAATACACCAATGGCGAGGG + Intergenic
1174168207 20:48599720-48599742 GTTAATTCCAACACTGGGGGAGG + Intergenic
1174441982 20:50563079-50563101 GTCAAGTAAAGCAGTGGGGATGG - Intronic
1178045711 21:28692032-28692054 TTTAACTAAACCACTTGGGAAGG - Intergenic
1180910280 22:19445159-19445181 GTTAACTGCCGCATTGGGAATGG - Intronic
1181282469 22:21729633-21729655 GTTGACAACACCACTGGTGAAGG + Intronic
1181689657 22:24551504-24551526 GTTAACTAGACCACAGGTGAGGG - Intronic
1182905527 22:33932467-33932489 CTTAACTAAAGAGCTGGGGAGGG + Intergenic
949396083 3:3615914-3615936 GGTGACTCCAGCCCTGGGGAGGG + Intergenic
951593921 3:24296725-24296747 GTTAACTCCAGCACCAAGGAGGG + Intronic
952881857 3:37990592-37990614 CTTAACCATAGCCCTGGGGAGGG + Intronic
953267977 3:41411687-41411709 GTTAATCACAGCACTTGGGGAGG - Intronic
953310778 3:41876652-41876674 GTATACTACATCACTGGTGATGG - Intronic
956506541 3:69946441-69946463 GTTAACAGCAGAACTGGGGGTGG - Intronic
959090593 3:101898849-101898871 GTTAACTACAGGGTTGGGGAGGG - Intergenic
961707420 3:128798408-128798430 TTTACCTAAAGCACTGGGCAAGG - Intronic
962457297 3:135576588-135576610 GTTAGCCAAGGCACTGGGGAGGG - Intergenic
962563065 3:136628444-136628466 TTTTTCTCCAGCACTGGGGATGG - Intronic
962773125 3:138631605-138631627 GGTACGTACAGTACTGGGGAAGG - Intronic
962882122 3:139588110-139588132 GTGACCTAGAGCAGTGGGGAAGG - Intronic
963746185 3:149127226-149127248 GGTGACAACACCACTGGGGATGG - Intergenic
968271909 3:197409524-197409546 TTTAACGACAGTACTCGGGATGG + Intergenic
968644055 4:1729884-1729906 GGTAACACCAGCACTTGGGAAGG - Intronic
968948197 4:3676531-3676553 GCGAACAACAGCACTGGGCATGG + Intergenic
972254808 4:37342104-37342126 GTTATCCTCAACACTGGGGATGG + Intronic
975209073 4:71678149-71678171 GATACCTTCAGCTCTGGGGATGG - Intergenic
976258899 4:83127151-83127173 GTTAATTCCAGGGCTGGGGAAGG - Intronic
977409051 4:96637970-96637992 GTCAACTGCAGGAGTGGGGAGGG + Intergenic
983969866 4:173858296-173858318 GTTGACTTCTGCACTGGAGAGGG + Intergenic
987467242 5:18286315-18286337 GTTAACTCCAGGGCTGGGGTGGG + Intergenic
987985544 5:25141288-25141310 GGCAACTACAGGACTGGGCATGG - Intergenic
991078309 5:62566981-62567003 GTTAACTACACAGCTGGGTATGG - Intronic
993906175 5:93625832-93625854 GTTAAAAACAGCACTGAGGGTGG + Intronic
994690020 5:103006191-103006213 GTTAATTACAGCACTTTGCAAGG - Intronic
997364983 5:133319907-133319929 GTGCCCGACAGCACTGGGGAAGG + Intronic
1000120648 5:158194719-158194741 GTTAAATATAGCACTGTGGCTGG - Intergenic
1006068024 6:31476583-31476605 GTGAACCACAGCTCTGTGGAGGG - Intergenic
1006396857 6:33793292-33793314 AGCAACTACAGCACTGGGGAAGG - Intergenic
1006829190 6:36958579-36958601 GTTAGGAACAGCACTGGGGCGGG + Intronic
1006928259 6:37671439-37671461 CTTAACTAAGGGACTGGGGAGGG - Intronic
1012760992 6:103300402-103300424 GTTAACTTCAGCACAGTGGAAGG - Intergenic
1015415955 6:132948912-132948934 GTTACCTAAAGCCCTTGGGAGGG + Intergenic
1017272126 6:152519308-152519330 GTTGATTCCAGGACTGGGGAGGG + Intronic
1018519808 6:164635371-164635393 GGCAACTTCTGCACTGGGGAAGG + Intergenic
1018778920 6:167044831-167044853 TTTAACAGCAGCACTGGGCAAGG + Exonic
1021123151 7:16819728-16819750 GTGAACTACAAGAGTGGGGAGGG - Intronic
1021838938 7:24706669-24706691 GTTACACACAGAACTGGGGAGGG + Intronic
1022464953 7:30647420-30647442 GTTAGCTACCGCACTTTGGAAGG - Intergenic
1030485777 7:110165495-110165517 TATAAATACAGCACTGGGCACGG + Intergenic
1032418663 7:131759632-131759654 TTTAACTACAACAGTGAGGACGG - Intergenic
1033294868 7:140123177-140123199 GGCAATTACAGCACTGGTGAGGG + Intronic
1033863165 7:145655038-145655060 ATTAACTACAGCACTTTGGGAGG + Intergenic
1038727412 8:30094204-30094226 CTTAATTATAGGACTGGGGATGG + Intergenic
1039824433 8:41161139-41161161 ATTAACTACAGCATTTTGGAAGG - Intergenic
1042502054 8:69519887-69519909 GTAAACTACAGAAATTGGGAAGG + Intronic
1044271422 8:90249061-90249083 TTTGACTACAGCAATGGGCATGG - Intergenic
1044745185 8:95364508-95364530 GGTAGCCACAGCACTTGGGATGG + Intergenic
1045048304 8:98300312-98300334 GTTAACTTCAGCACAAGGGTGGG + Intergenic
1050349262 9:4724208-4724230 TTTGACTACTGCTCTGGGGAGGG + Intronic
1050844102 9:10192200-10192222 GATACCTACAGCACTGTGAAAGG + Intronic
1053611856 9:39722056-39722078 CTTAACTACAGCTTTGGGGAAGG - Intergenic
1053869894 9:42480050-42480072 CTTAACTACAGCTTTGGGGAAGG - Intergenic
1054086400 9:60749099-60749121 CTTAACTACAGCTTTGGGGAAGG + Intergenic
1054241665 9:62620337-62620359 CTTAACTACAGCTTTGGGGAAGG + Intergenic
1054555791 9:66654860-66654882 CTTAACTACAGCTTTGGGGAAGG + Intergenic
1056200301 9:84269186-84269208 GTTAAATACTGCACTGTGTATGG + Intergenic
1061888795 9:133606820-133606842 AATAATTACAGCACTCGGGAGGG - Intergenic
1062182713 9:135199296-135199318 CATAGCTGCAGCACTGGGGAGGG + Intergenic
1186236056 X:7510847-7510869 TTGAAACACAGCACTGGGGATGG + Intergenic
1186751934 X:12630372-12630394 GTTATTTACAGAAATGGGGATGG + Intronic
1191048228 X:56162355-56162377 GTAGACTACAGCACCGGGGCAGG - Intergenic
1192093009 X:68181149-68181171 GTTACTTACAGCACTAAGGAAGG - Intronic
1192433167 X:71126078-71126100 GATATCTTCAGCAGTGGGGAAGG - Exonic
1193723822 X:85017711-85017733 GTTAAAAGCAGCAGTGGGGAAGG - Intronic
1195084384 X:101400505-101400527 TATAATTACAGCAGTGGGGATGG + Intronic
1195801983 X:108722932-108722954 TTTAAGTACAGCATTGGTGATGG + Intronic
1196368993 X:114954260-114954282 TTTAACTAGAGCAAAGGGGATGG + Intergenic
1197371035 X:125626897-125626919 ATCAGCTACAGCACTGGGTAGGG - Intergenic
1198496546 X:137199106-137199128 GTTAACTACTGGGCTGGGCATGG - Intergenic