ID: 1089207112

View in Genome Browser
Species Human (GRCh38)
Location 11:116773103-116773125
Sequence GGCCACCGGGACGCGCTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089207104_1089207112 28 Left 1089207104 11:116773052-116773074 CCACGGCCGGAAGTGGCGGAGAG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1089207105_1089207112 22 Left 1089207105 11:116773058-116773080 CCGGAAGTGGCGGAGAGTGCTAA 0: 1
1: 0
2: 0
3: 3
4: 75
Right 1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089207112 Original CRISPR GGCCACCGGGACGCGCTCGC AGG Intergenic
900189905 1:1348973-1348995 GGCCAGCGTGACGCGCTCGGGGG + Exonic
903302051 1:22386155-22386177 GGCCACAGGGAGGCGATGGCAGG - Intergenic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
912993573 1:114511514-114511536 GACGCCCGGGACACGCTCGCAGG - Intergenic
919726948 1:200890971-200890993 GGGCAGCAGGAGGCGCTCGCCGG + Intergenic
1076977929 11:189586-189608 CGCCACCGGGACGAGAGCGCGGG + Intronic
1083883005 11:65557765-65557787 GACCACCTTGAAGCGCTCGCGGG + Exonic
1085332919 11:75668079-75668101 CGCCGCCGGCTCGCGCTCGCCGG + Exonic
1089207112 11:116773103-116773125 GGCCACCGGGACGCGCTCGCAGG + Intergenic
1101102438 12:101407603-101407625 GGGCACCTGGGCGCGCTCGAGGG - Intronic
1101817125 12:108153773-108153795 GGCCAACGGGAGGCCCTGGCAGG - Intronic
1103595341 12:122021781-122021803 GGCCACCGGGCAGCGCCCCCGGG - Exonic
1103763722 12:123268087-123268109 GGCCACTGGGACGCCATTGCGGG - Intronic
1106602572 13:31200268-31200290 GGACGGCGGGACGCGCGCGCCGG - Intronic
1107873061 13:44764631-44764653 GGCCCCAGGGATGCGCTGGCAGG - Intergenic
1121613158 14:95294777-95294799 GGCCAATGGGAGGCGCTGGCAGG + Intronic
1124426890 15:29570415-29570437 GGCCGCCGGGACGCCACCGCGGG - Intronic
1125071305 15:35557127-35557149 AGCCAGCGGGACGCACTGGCAGG - Intergenic
1126035067 15:44537608-44537630 GGCCTCCCGGACTCCCTCGCCGG + Intronic
1129744374 15:78007914-78007936 GGCCAGCGGGAGGTGCTGGCAGG - Intronic
1132761958 16:1513005-1513027 GGCGACCGTGTCGGGCTCGCTGG - Intronic
1136484292 16:30561396-30561418 GGCCACCTAGACGCGCTCAGCGG - Intergenic
1136561597 16:31042340-31042362 GGCCACCGGGAGGCGCAGTCGGG - Intronic
1136561604 16:31042361-31042383 GGCCACCGGGAGGCGCTGCGGGG - Intronic
1138200354 16:55083697-55083719 GGACACCGGGACCCACTCCCAGG - Intergenic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1142711053 17:1724446-1724468 AGCCTCCGGGACCCGCGCGCTGG + Intronic
1142859989 17:2755629-2755651 GGTGTCCGGGGCGCGCTCGCGGG - Intergenic
1142863316 17:2776523-2776545 GGGCACCGGGAGGCGGTGGCAGG - Intergenic
1144586817 17:16492176-16492198 GGCTACCCGGGCGCGCTCCCCGG + Intergenic
1147994526 17:44353665-44353687 GGCCCCCGGGGCGCGCACCCTGG + Exonic
1151477897 17:74354205-74354227 GGCCGCCCGGCGGCGCTCGCGGG + Exonic
1151570910 17:74924906-74924928 CCCTACCGGGACGCGCACGCTGG + Exonic
1151678474 17:75611885-75611907 GGCCATCGGGACGCCCTGGCTGG + Intergenic
1152729299 17:81961749-81961771 GGCCACTGGGCCGCCCGCGCTGG - Intronic
1155209154 18:23586251-23586273 GGCCACCGGGACGCCCTGTGGGG - Intronic
1157867010 18:51196604-51196626 GGGCACCGGGACGCACTCGGTGG + Exonic
1160038467 18:75322190-75322212 GGCCACCAGGACCCTCTCTCAGG - Intergenic
1160745616 19:709600-709622 GGCGCCCTGGACGCGCGCGCGGG + Intronic
1160864327 19:1250352-1250374 GGCCGCCGGGCCCAGCTCGCAGG - Exonic
1161001266 19:1912392-1912414 GGCCTCGGGCCCGCGCTCGCTGG + Exonic
1162914037 19:13865091-13865113 GCGCACCGGGACGCACTCGGGGG - Intronic
1163782548 19:19258002-19258024 GGCCTCCGCAGCGCGCTCGCGGG + Exonic
1167258015 19:48442727-48442749 GTCCACTGAGGCGCGCTCGCGGG - Exonic
1167389270 19:49183098-49183120 GGCCACCTCGCCGCTCTCGCTGG + Exonic
929756354 2:44768676-44768698 GGGCTCCGGGACGCGGCCGCCGG + Intronic
929779763 2:44949935-44949957 GGCCACCGGGGCCCGCACACTGG - Intergenic
941934670 2:170973647-170973669 GGTCTCCGGGCCGCCCTCGCAGG + Intergenic
1168777750 20:462282-462304 GCCCCCCGGGCCGCCCTCGCAGG + Intronic
1169113349 20:3046804-3046826 GGGCACCGCGACGCGGGCGCTGG + Intronic
1169143331 20:3238138-3238160 GGCGGCCGGGACGCGGTCCCAGG - Exonic
1173516203 20:43667164-43667186 GGGCCCCGGGCCGCGCTCGAAGG - Exonic
1173704117 20:45097676-45097698 TTCCACCGGGCTGCGCTCGCTGG - Exonic
1178561641 21:33643323-33643345 GGACCCGGGGACGCGCTCACAGG - Intronic
1184663740 22:45977020-45977042 GGCCCCCGGCCCGCGCTTGCAGG - Exonic
1184680764 22:46071258-46071280 GCCCGCGGGGACGCGCACGCGGG + Intronic
949260552 3:2099028-2099050 TGCCCCGGGGACGCGGTCGCGGG + Intronic
950829496 3:15859884-15859906 GGCCACGCCGCCGCGCTCGCTGG + Intergenic
952764690 3:36944409-36944431 TGCCCCGGGGGCGCGCTCGCTGG + Intronic
954104017 3:48399369-48399391 GGCCAACGGGACGGGCTGGCAGG + Intronic
960120826 3:113947757-113947779 TGCCTCCTGGACGCGCTCTCGGG + Intergenic
961012738 3:123447375-123447397 GGCCACCGGGACTGGATTGCGGG - Intronic
969357749 4:6640529-6640551 GGCCGCACGGACGCGCACGCAGG - Exonic
972222028 4:36966758-36966780 GGCCACTGGGAAGCTCTAGCTGG - Intergenic
985996770 5:3601207-3601229 GGCCACCTGGACGCGAGCTCGGG - Exonic
986506580 5:8457937-8457959 GGGCCCAGGGACGCGCTCCCGGG - Intergenic
997869962 5:137498473-137498495 CGGCACCTGGACGCGCTCGCCGG - Exonic
1029168739 7:98616679-98616701 GGTCCCCGGGACGCGCTCCATGG - Intergenic
1031144086 7:117978720-117978742 GGCCAATGGGAGGCACTCGCAGG + Intergenic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1033186619 7:139232038-139232060 GGCGACCCGGACGCGCTCGGTGG - Intronic
1033269367 7:139916826-139916848 GGCCACAGGGACCCGCCTGCTGG + Intronic
1035355757 7:158275222-158275244 GGCCACAGAGACGTGCTCCCTGG + Intronic
1036755277 8:11467163-11467185 GGCCCACGGTAGGCGCTCGCGGG - Intronic
1038765689 8:30425685-30425707 AGCCACCGGGCCGGGCTCGGTGG - Intronic
1050357086 9:4793329-4793351 GCCCTCCCCGACGCGCTCGCCGG - Intronic
1051774514 9:20620546-20620568 GCCCCCCGCGCCGCGCTCGCCGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1062325694 9:136011544-136011566 GGCCTCCGGGCCGCGGCCGCCGG + Exonic
1189281322 X:39821667-39821689 GACCGCCGGGCCGCGCTCCCCGG + Intergenic
1190062273 X:47219103-47219125 CGCCTCGGGGACGCGCTCACCGG - Intronic
1190323422 X:49191661-49191683 GGGCGCCGGGAGGCGCGCGCAGG + Exonic