ID: 1089209457

View in Genome Browser
Species Human (GRCh38)
Location 11:116790557-116790579
Sequence GAGGCGCGCGGGGCTGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 0, 2: 6, 3: 99, 4: 832}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089209446_1089209457 20 Left 1089209446 11:116790514-116790536 CCTTGAGCGTGAGCTTCCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832
1089209447_1089209457 4 Left 1089209447 11:116790530-116790552 CCGGGAGAGCACCTGCACGCAGC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832
1089209449_1089209457 -7 Left 1089209449 11:116790541-116790563 CCTGCACGCAGCGACTGAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832
1089209443_1089209457 26 Left 1089209443 11:116790508-116790530 CCTTGGCCTTGAGCGTGAGCTTC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089209457 Original CRISPR GAGGCGCGCGGGGCTGGCGG GGG Exonic
900000203 1:10656-10678 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000208 1:10685-10707 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000213 1:10714-10736 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000218 1:10743-10765 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000223 1:10772-10794 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900000235 1:10844-10866 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019905 1:181165-181187 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019910 1:181194-181216 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019922 1:181252-181274 GAGGCGCGCCGGGCCGGCGCAGG + Intergenic
900019927 1:181281-181303 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019932 1:181310-181332 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
900019953 1:181433-181455 GAGGCGCGCCGTGCTGCCGCAGG + Intergenic
900103117 1:971217-971239 GAGGTGCGTGGGGCTGTAGGGGG + Intronic
900190114 1:1349607-1349629 GGGGCGCTCGGGTCGGGCGGAGG + Intergenic
900314564 1:2050461-2050483 GCGGCGCGCGGGGCGGGAGCGGG - Exonic
900479690 1:2891982-2892004 ACGGAGCGCGGGCCTGGCGGGGG + Intergenic
900513127 1:3069584-3069606 GAGGCGCGCGGTGGGGGCCGGGG + Intronic
900513458 1:3070684-3070706 GGTGCGCGCGGGACTCGCGGCGG + Intronic
900566057 1:3332396-3332418 GGGGGGCTCGGGGCTGGGGGAGG + Intronic
900633307 1:3650002-3650024 GTGGCGCCCGCGGCAGGCGGCGG - Exonic
900666608 1:3819872-3819894 GAGGCCCCCGGTGCTGACGGTGG + Intronic
901016620 1:6235671-6235693 GGGGCCGGCGGGGCGGGCGGCGG - Intronic
901057623 1:6456012-6456034 GCGGCGGGCGGGGGCGGCGGCGG - Intronic
901066595 1:6497338-6497360 GCCGCGCGGGGGGCGGGCGGCGG + Intronic
901404006 1:9033928-9033950 GAGGGGAGTGGGGCTGGCTGGGG - Intergenic
901428603 1:9198938-9198960 CAGGCGGGCGGGGAGGGCGGGGG + Intergenic
901443469 1:9293128-9293150 GAGGCGCGGGGGGCCGGGCGAGG + Intronic
901489495 1:9589305-9589327 GAGCCGCGGGGGGCTGGAGCCGG + Intronic
901506638 1:9689597-9689619 CAGCGGCGCGGGGCCGGCGGGGG - Intronic
901634386 1:10663835-10663857 GTGGAGAGCGGGGCTGGCAGAGG - Intronic
902520290 1:17011843-17011865 GAGGGGCGCTGGGCTAGCGCGGG + Intronic
902940984 1:19799973-19799995 GGCGCGCTCGGGGCAGGCGGCGG - Intergenic
903349976 1:22711398-22711420 GAGGGGCGCGGGCCCGGCCGTGG + Intronic
903738247 1:25543829-25543851 GAGGCGCGCGGGGCCTCCGCGGG + Intronic
903774920 1:25786873-25786895 CAGCCGCACGGGCCTGGCGGGGG - Intergenic
904321097 1:29698242-29698264 GAGCAGGGCGGGGCTGGGGGTGG + Intergenic
904993632 1:34614034-34614056 GAGGCGGGAGGGGCAGGCAGGGG - Intergenic
905124683 1:35708273-35708295 GAGGGGCTCGGGCGTGGCGGGGG - Intergenic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
905432084 1:37931743-37931765 GGAGCGCGCGGGACGGGCGGCGG - Intronic
905912180 1:41662487-41662509 GAGGCGCCCCGGGCCGGCGGCGG - Intronic
905922269 1:41727588-41727610 GAGGGGCGCGGCGCCGCCGGAGG + Intronic
906083122 1:43107484-43107506 GAGGGGCGGGGGGCAGGGGGTGG + Intergenic
906615837 1:47232253-47232275 GGCGGGCGCGGGGCGGGCGGGGG - Intergenic
906756619 1:48323417-48323439 GAGGGGTGGGGGGCTGGGGGAGG + Intronic
907136153 1:52141827-52141849 AAGGTGCTCGGGTCTGGCGGGGG + Intergenic
907188991 1:52633261-52633283 GGGGCAGGCGGGGCGGGCGGCGG - Intergenic
907689146 1:56645253-56645275 GAGGGGCGCGGGGCGGGCGCGGG - Intronic
908356349 1:63327810-63327832 GAGGCGTCCGGGGCTGGGGCTGG - Intergenic
908473743 1:64469896-64469918 GAGGCGGGGAGCGCTGGCGGGGG + Intergenic
908951592 1:69568318-69568340 GCGGCGCGCTGGGCAGGCTGAGG + Intergenic
910292902 1:85616309-85616331 GAGGCCCGCGGCGATGGCAGGGG - Intergenic
910915655 1:92285463-92285485 GGGGCGTGGGGGGCTGGGGGAGG + Intronic
911527590 1:99004916-99004938 GGGGCGGGCGGCGCTTGCGGCGG - Intronic
913129750 1:115828772-115828794 GACGGGCGCGGGGTGGGCGGGGG - Intergenic
913250671 1:116910085-116910107 CAGGCGCGCGGCCCAGGCGGAGG + Exonic
914069775 1:144276697-144276719 GAGGCGCGGGGGGCGGGACGCGG - Intergenic
914109380 1:144689657-144689679 GAGGCGCGGGGGGCGGGACGCGG + Intergenic
914240096 1:145847420-145847442 GAGCTGGGCGGGGGTGGCGGGGG + Intronic
914246041 1:145886291-145886313 GAGGCGGGGGGAGTTGGCGGGGG - Intergenic
914753161 1:150549332-150549354 GTGGCGGGCGGGGCTGGGCGGGG + Intergenic
914803050 1:150974457-150974479 GAGGGAGGCGGCGCTGGCGGGGG - Intronic
914803165 1:150974766-150974788 GCGGCGCCGGCGGCTGGCGGAGG - Exonic
914813631 1:151047723-151047745 GAGGCCCGCGGGGAAGGGGGTGG - Exonic
914918127 1:151830793-151830815 GAGGTGGGCGGGGCTGGGTGGGG - Intronic
915127849 1:153678513-153678535 GAAGCGCGCGGGCTGGGCGGCGG + Intergenic
915246388 1:154558738-154558760 GAGGGGCGCGCGGCTTCCGGCGG - Intronic
915511316 1:156388476-156388498 GGGGCGCGCAGGGCCGGAGGCGG - Intergenic
915932798 1:160070281-160070303 GAGGGGGGCCGGGCAGGCGGGGG + Intergenic
915934932 1:160084898-160084920 GAGGGGAGCGGGGTTGGCAGAGG + Intronic
916548431 1:165828026-165828048 GAGGCGCGCGGGCCACGCGGTGG - Intronic
916605990 1:166343081-166343103 GGGGCGCGTGGGGGGGGCGGGGG + Intergenic
917150065 1:171933594-171933616 GAGGCAAGTGGGGCTGGAGGTGG + Intronic
918040693 1:180912594-180912616 GAGGCGCGCGGGGCGCACGGAGG - Intergenic
918064289 1:181089161-181089183 GAGGCACGAGCGGCGGGCGGGGG - Exonic
919748626 1:201023474-201023496 GGCGCGGGCGCGGCTGGCGGAGG + Exonic
919975262 1:202606506-202606528 GAGTCTCGCGGGGCAGGAGGAGG - Intronic
920313859 1:205064395-205064417 GAGCTGCCCGGGGCTGGCAGGGG - Exonic
921604421 1:217137745-217137767 GAGGCGCGCGGGGGAGGGCGAGG - Intronic
922440533 1:225652659-225652681 GGGGCGCGCGGGGCGGGGGCCGG - Intronic
922917650 1:229271390-229271412 GGGGCGCGCGGGTCGGGCCGCGG + Intronic
922925239 1:229342552-229342574 GCGGCGGGCAGGGCCGGCGGAGG - Intronic
923055982 1:230426156-230426178 GCCGCGCGCGGGGCTGGCAGGGG + Intergenic
923141210 1:231162612-231162634 GAGGCGCGCGCTGCAGCCGGCGG + Intronic
924289506 1:242523984-242524006 GGGGCGCGGGGGGCAGGCGAGGG - Intronic
924561119 1:245156688-245156710 GCGCCGCGCGGGGCTGGCTGGGG + Intronic
1063450128 10:6145364-6145386 GGGACGCGCGGGTCTGGAGGAGG - Intronic
1064229536 10:13517855-13517877 CAGGGGAGCGGGGCTGGCGAAGG - Intronic
1064231009 10:13529120-13529142 GCGGCCCCCGGGGATGGCGGCGG - Intergenic
1064244320 10:13657154-13657176 GCGGCGCGCGGGGGTGCGGGGGG - Exonic
1065069059 10:22003492-22003514 GTGGCGGGCGGCGCTGGCTGTGG + Exonic
1065099852 10:22321744-22321766 GGGCCGCGCGGGGCTCGGGGCGG + Intronic
1065214748 10:23439074-23439096 GAGGAGCGCGGTGCGCGCGGAGG - Intergenic
1065239883 10:23694794-23694816 GAGGAGCGCGGGAACGGCGGCGG - Intronic
1065253841 10:23844880-23844902 GAGGTGCGGGGGGCTAGGGGAGG - Intronic
1065343310 10:24724878-24724900 GAGCCTCGCGGGGCTGGAGGGGG + Intergenic
1065817033 10:29491713-29491735 GAGGCCCGCGCAGCTGGAGGTGG - Intronic
1066464891 10:35642343-35642365 TTGGCTCGCGGGGCTGGGGGCGG - Intergenic
1067084369 10:43230058-43230080 CTGGCGCGCGGGGCCGGCGAGGG + Intronic
1067090719 10:43264747-43264769 GAGGGGCGCTGGGCTGCTGGGGG - Intronic
1067296019 10:44975514-44975536 GAGGGGAGTGGGGCTGGGGGTGG - Intronic
1067669646 10:48307061-48307083 CAGGCGGGCGGGGCTCGCGGCGG - Intronic
1069557774 10:69408859-69408881 AGGGGGCGGGGGGCTGGCGGGGG - Intronic
1069703388 10:70441849-70441871 GAGGCCCGCAAAGCTGGCGGAGG + Intronic
1069982301 10:72260952-72260974 GAGGAGGGCGGGGCTGGCCCTGG - Intergenic
1070162599 10:73874742-73874764 CAGGCGCGCGGGGCAGCCGAGGG + Intergenic
1071579468 10:86756506-86756528 GGTGCGCGCGGCGCGGGCGGGGG + Intergenic
1071676322 10:87659531-87659553 GAGGCGCGGGAGGCTGGTGAGGG + Intergenic
1072421092 10:95291027-95291049 GGGGAGCCTGGGGCTGGCGGGGG + Intergenic
1072662293 10:97370430-97370452 GAGGCCCAGGGGGCTGGGGGTGG - Intronic
1072719364 10:97771273-97771295 GGAGCGCGCGGGGACGGCGGCGG + Intronic
1073048714 10:100654767-100654789 GAGTCGCGCGGCGACGGCGGCGG - Intergenic
1073057261 10:100710504-100710526 GAGGGGCGCCGGGCAGGCGCAGG + Intergenic
1073060486 10:100730700-100730722 GAGGCGCGCGGGGCCGAGCGCGG + Intergenic
1073076141 10:100826854-100826876 GTGGCGGGCGGGCCGGGCGGAGG - Intronic
1073076420 10:100827844-100827866 GCGGCAGGCGGGGCTGGGGGCGG - Exonic
1073207270 10:101775824-101775846 GGGGCGCGGGGGGCGGGTGGCGG + Intronic
1073207396 10:101776220-101776242 GGGGAGCGCGGGGCGGGCGGCGG + Intronic
1073292384 10:102419638-102419660 GGGGCGCGCGGGGCTCACCGCGG + Intronic
1073336597 10:102714575-102714597 GAGGGGCGTGGGGCGGGCGTGGG + Exonic
1073403572 10:103277709-103277731 GGAGCGCGACGGGCTGGCGGAGG + Exonic
1074591835 10:114821626-114821648 GCCTCGCGCGGGGCTGGAGGCGG - Intergenic
1075069934 10:119313972-119313994 GAGGCGCGTGGGGCGGCCCGGGG - Intronic
1075129579 10:119726362-119726384 GAGGCTGGCGGTGCGGGCGGGGG + Intronic
1075334524 10:121598571-121598593 GAGCCGCGCGGGACTCGGGGCGG - Intergenic
1076404624 10:130203739-130203761 GAGGCGGGAGGGGCAGGTGGAGG - Intergenic
1076404632 10:130203758-130203780 GAGGCGGGAGGGGCAGGTGGAGG - Intergenic
1076404640 10:130203777-130203799 GAGGCGGGAGGGGCAGGTGGAGG - Intergenic
1076633208 10:131865381-131865403 GGGGCTGGAGGGGCTGGCGGTGG + Intergenic
1076792599 10:132785200-132785222 GCGGGGCCCGGGGCTGGCGCTGG + Intronic
1076850130 10:133088559-133088581 GCTGCGCCTGGGGCTGGCGGAGG - Intronic
1076878766 10:133230136-133230158 GGGGCGCGCGGGGCGGGGCGGGG + Intergenic
1076963521 10:133786473-133786495 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
1076963528 10:133786502-133786524 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
1077048120 11:555132-555154 GAGGCGCGCGGGGCGGGGCGGGG + Intronic
1077049748 11:561282-561304 GGGGCTCCCCGGGCTGGCGGGGG + Exonic
1077063339 11:627075-627097 GGGGGGCGCGGGGCGCGCGGCGG + Exonic
1077140478 11:1022103-1022125 GAGGGGCGCGGGGCTGCAGAGGG - Intronic
1077140495 11:1022172-1022194 GAGGGGCGCGGGGCTGTAGAGGG - Intronic
1077140521 11:1022281-1022303 GAGGGGCGCGGGGCTGTAGAGGG - Intronic
1077173746 11:1179624-1179646 GAGGAGGGCGTGGCTGACGGAGG + Intronic
1077225090 11:1436150-1436172 GAGGGAGGCGGGGCCGGCGGTGG + Intronic
1077250919 11:1560329-1560351 GGGGCACGCGGGGCAGGCAGTGG - Intronic
1077323573 11:1953583-1953605 GAGGCGGCCGGGGCAGGCTGTGG - Intronic
1077324839 11:1959237-1959259 GAGGAGCGCGGAGCAGGCCGGGG + Intronic
1077332877 11:1991028-1991050 GAGCGGCGCGGGGCTGGGGCCGG - Intergenic
1077372450 11:2189676-2189698 GGGCTGCGGGGGGCTGGCGGAGG + Intergenic
1078246180 11:9574396-9574418 GGGGCGCGCCGGGCGGGCGAAGG + Exonic
1078377403 11:10808057-10808079 GCTGGGCGCCGGGCTGGCGGGGG - Intronic
1078514151 11:12008685-12008707 GGGGCGCCAGGGGCGGGCGGCGG - Intronic
1078538178 11:12192041-12192063 GTGGCGGGCGGGGGTGGGGGTGG - Intronic
1079076812 11:17389409-17389431 GAGGGGCGCGGGAGGGGCGGGGG - Intergenic
1079090481 11:17476898-17476920 GAGGCCAGCGGGGCTGGGCGGGG - Intergenic
1080283817 11:30586139-30586161 GGGGCGCGCGGGGGCGGCGAGGG + Intronic
1081576254 11:44320095-44320117 GAGATGCGCGGGGCGGGGGGCGG - Intergenic
1081807183 11:45896954-45896976 GGGGCTACCGGGGCTGGCGGGGG + Intronic
1081808565 11:45902842-45902864 GAGGCCCGTGGAGGTGGCGGCGG - Exonic
1081812902 11:45923171-45923193 GGTGCGCGCGGCCCTGGCGGCGG + Intronic
1081851484 11:46277928-46277950 GGGGGGCGCGGGGCGCGCGGGGG - Exonic
1082160427 11:48883245-48883267 GAGGTGCACAGGGCTGGGGGTGG + Intergenic
1082161939 11:48897161-48897183 GAGGTGCACAGGGCTGGGGGTGG - Intergenic
1082740695 11:56907877-56907899 GGGGGGTGCGGGGCTGGGGGAGG - Intergenic
1082824448 11:57567703-57567725 GGGGTGGGCGGGGCTGCCGGGGG - Exonic
1082828380 11:57597873-57597895 GAGGCGGGAGGGGCTGGGGTAGG - Intronic
1083272982 11:61581278-61581300 GAGGCGGGCGGGGCGCGGGGCGG - Intergenic
1083303764 11:61752562-61752584 GGGGCGCGTGGGGCGGGCAGGGG + Intergenic
1083579100 11:63813563-63813585 GGGCTGCGCGGGGCGGGCGGCGG + Exonic
1083741255 11:64712782-64712804 AGGGCGCGTGGGGTTGGCGGTGG - Intronic
1083741393 11:64713315-64713337 GCGCCGCACGGCGCTGGCGGTGG - Exonic
1084070122 11:66728320-66728342 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1084112522 11:67023302-67023324 GAGGAGCGCGGCGCGGGCCGGGG - Intronic
1084412084 11:69011139-69011161 GAGGAGTGCGCGGCGGGCGGGGG - Intronic
1084425743 11:69083782-69083804 GAGGCGTGTGGGGGTGGCTGTGG + Intronic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089457728 11:118635070-118635092 GTGGCCCGCGGGGCCGGGGGAGG - Intronic
1089498049 11:118917765-118917787 GAGTTGGGCGGGGCTGGGGGAGG - Intronic
1089556243 11:119317218-119317240 GCGGCGCGCGGGGCGGGGGCTGG - Intronic
1090799136 11:130159883-130159905 GGGGCGCGGGGCGCAGGCGGCGG - Exonic
1091372957 11:135076192-135076214 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372962 11:135076221-135076243 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372967 11:135076250-135076272 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372972 11:135076279-135076301 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372977 11:135076308-135076330 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1091372982 11:135076337-135076359 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1202807819 11_KI270721v1_random:14414-14436 GAGGAGCGCGGAGCAGGCCGGGG + Intergenic
1202815860 11_KI270721v1_random:46204-46226 GAGCGGCGCGGGGCTGGGGCCGG - Intergenic
1091373282 12:10752-10774 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373287 12:10781-10803 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373292 12:10810-10832 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373297 12:10839-10861 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373302 12:10868-10890 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373307 12:10897-10919 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373312 12:10926-10948 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091373334 12:11049-11071 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1091383630 12:78252-78274 GATGCTCCCCGGGCTGGCGGCGG - Intronic
1091761290 12:3088874-3088896 CAGGCGCGGGAGGCTGGTGGTGG + Intronic
1092228965 12:6766512-6766534 GAGGCGCGCGGGGTGGGGCGGGG - Exonic
1092229073 12:6766824-6766846 GGGCCGCGCGGGGCCGTCGGGGG - Intronic
1092263161 12:6963096-6963118 GAGGTGCCCGTGGCTGGCGCTGG + Intergenic
1092539791 12:9413631-9413653 GAGGGGCGGGGGGCGGGGGGCGG + Intergenic
1094565030 12:31591172-31591194 TGGGAGCGCGGGGCGGGCGGGGG + Intergenic
1096127672 12:49131477-49131499 TGGGCGCGCGGGGCCGGAGGAGG - Intergenic
1096148696 12:49295701-49295723 GGAGCGCGACGGGCTGGCGGAGG + Exonic
1096204187 12:49707341-49707363 GGGGCGCGCGGCGAGGGCGGAGG + Exonic
1096220559 12:49826137-49826159 GAGGTGGGCAGGGCTGGGGGTGG + Intronic
1096337058 12:50764411-50764433 GTCGCGCGCGGTGGTGGCGGTGG + Intronic
1096503576 12:52079872-52079894 GCCGCGCGCGGTGCAGGCGGTGG + Intergenic
1096647664 12:53047384-53047406 GCGCCGCGCTGGGCGGGCGGCGG + Intronic
1096649368 12:53054344-53054366 GGGCCGCGCGGGGAAGGCGGCGG - Exonic
1098600551 12:72326398-72326420 GAGGGGCGCGGGGCTAGGGGAGG + Intronic
1098943124 12:76559811-76559833 GGGGCGGGCGGGGCAGGGGGAGG - Intergenic
1099409721 12:82310632-82310654 GGGGGGCGGGGGGCTGGGGGAGG - Intronic
1099440083 12:82687836-82687858 GAGGCGCGCTGGGCGGGCCGAGG + Intronic
1100963077 12:99984756-99984778 GAGGAGCGCGGCGGCGGCGGCGG + Intergenic
1101350953 12:103929826-103929848 GGGGGGCGGGGGGGTGGCGGTGG - Intergenic
1101493950 12:105236124-105236146 GACGCGCGCGGGGCCGCCGCGGG - Intronic
1102025772 12:109713764-109713786 GGGCCGCGGGGGGCGGGCGGGGG + Intergenic
1102646173 12:114405366-114405388 GGGGAGCTCTGGGCTGGCGGAGG + Intronic
1102854043 12:116277765-116277787 GGGGAGCGAGGGGCGGGCGGGGG + Intergenic
1102948441 12:117011004-117011026 GGGGCGCCCGGGGCTGGCACAGG - Intronic
1103085686 12:118060876-118060898 GGTCCGCGCGGGGCCGGCGGGGG - Intronic
1103920057 12:124394671-124394693 CAGGCGCCAGGGGCTGGGGGAGG + Intronic
1103962336 12:124617029-124617051 GAGGCGGGAGGGGAGGGCGGAGG - Intergenic
1104944427 12:132409369-132409391 GAGACGTGAGGGGCTGGAGGGGG - Intergenic
1104980132 12:132570022-132570044 ATGGGGCGCGGGGCTGGCAGTGG - Exonic
1105000408 12:132687070-132687092 GAGGGGCTCGGGGCGGGCGGAGG - Intronic
1105049711 12:133037602-133037624 GAGGCGCGCGGGAGTGGCCGCGG + Exonic
1106157642 13:27172194-27172216 GGGAGGCGCGGGGGTGGCGGCGG + Intergenic
1106517107 13:30465242-30465264 GCGGCGCGGGGGCCTGGGGGCGG - Intronic
1107133560 13:36920492-36920514 GGGCAGCGCGGGGCTGGGGGTGG - Intronic
1107549035 13:41457951-41457973 GGCGCGCGCGGAGCTGGTGGTGG - Intronic
1108373366 13:49792359-49792381 GAGGGGCGGGGGGCCGGCGCCGG - Intronic
1108662615 13:52600369-52600391 GAGGGGCGCGGGGCGGGCCTCGG - Intergenic
1108676022 13:52738931-52738953 GAGGGGCGCGCGGCTGCCGGCGG - Intronic
1109899920 13:68753923-68753945 GGGGGGTGCGGGGCTGGGGGAGG + Intergenic
1111657818 13:91175019-91175041 AAGGCGCCCGGGGCCGGCGAGGG - Intergenic
1112505136 13:99970814-99970836 GATGCGCCTGGGGCTGGCGGCGG - Exonic
1113441252 13:110330390-110330412 GAGGCGCGGGGTGGAGGCGGGGG + Intronic
1113814397 13:113161447-113161469 GAGACCCACGGGGCTGGGGGAGG + Intronic
1113841555 13:113364169-113364191 GAGAGGGGCGGGGCTGGAGGCGG + Intergenic
1113868663 13:113545128-113545150 AAGGTGAGCGAGGCTGGCGGGGG - Intronic
1115474355 14:33799707-33799729 GTGGGGCGGGGGGCCGGCGGTGG - Intronic
1116080483 14:40164245-40164267 GGGGTGCGGGGGGGTGGCGGGGG + Intergenic
1116657975 14:47675002-47675024 GCGGCGCGCTGGGCCGGCGGCGG + Intergenic
1117092796 14:52267720-52267742 GCCGCGCGCGGAGCTGCCGGGGG + Exonic
1117157042 14:52951274-52951296 GGGCGGCGCGGGGGTGGCGGGGG + Intronic
1117315403 14:54567104-54567126 AAGGGGCGCGGGGGTGGGGGTGG - Intronic
1117315590 14:54567854-54567876 GGGGCGGGCGGGGCGGGCTGGGG + Exonic
1117478164 14:56118294-56118316 GGGCCGCGCGGGGGAGGCGGGGG - Intronic
1119385896 14:74258038-74258060 GGGCCGCGAGGGGCTGCCGGGGG + Intronic
1121473636 14:94174845-94174867 AAGGGCCGCGGGGCTGGCGCCGG - Intronic
1122145188 14:99684534-99684556 CAGGTGAGCGGGGCTGGGGGCGG + Exonic
1122558021 14:102592030-102592052 AGGGGACGCGGGGCTGGCGGGGG - Intergenic
1122581998 14:102777176-102777198 GAGGCCCGCGGGGCGCGCGGCGG + Intergenic
1122892200 14:104737688-104737710 GAGGCGCCAGGGGCTGGGAGAGG - Intronic
1122917542 14:104865835-104865857 GAGGCGGCCGGGCCCGGCGGGGG - Intronic
1122985699 14:105210698-105210720 GGGGCGCGGGGGGCTGGGGCTGG - Intronic
1123004260 14:105314122-105314144 GAGGTGGCCGGGCCTGGCGGCGG - Exonic
1123004452 14:105314678-105314700 GGCGCGCGCGGGGCGGCCGGGGG + Exonic
1123037813 14:105478549-105478571 GAGGGGCGTGGCGCTGGCGCTGG + Intronic
1123044159 14:105503281-105503303 GAGGGGCCCGGGGCTGGTGAGGG + Intergenic
1123044399 14:105504188-105504210 GAGGAGCTCTGGGCTGGTGGGGG + Intergenic
1123201170 14:106666007-106666029 GGGGCGCGCGGGGCCACCGGGGG - Intergenic
1123215144 14:106802622-106802644 GGGGCGCGCGGGGCTACCAGGGG - Intergenic
1124038983 15:26082699-26082721 GAGCCGCGCGGGCCTGGCTCCGG + Intergenic
1124427056 15:29570980-29571002 GGAGCGCGCGGGGCGGGCGGGGG - Intergenic
1124439246 15:29674945-29674967 GAAGCCAGCGGGGCTGGCGGAGG - Intergenic
1124712960 15:32030442-32030464 GAGGCGCGCGGGGGCGGGCGGGG + Intergenic
1126730885 15:51681390-51681412 GAGGCGGGAGGGGATGGCGTCGG - Exonic
1126987161 15:54325552-54325574 GAGGGGTGAGGGGCTGGGGGAGG - Intronic
1128173118 15:65530445-65530467 GTGACGCGCCGGGATGGCGGCGG - Exonic
1128528905 15:68431199-68431221 GAGGGGCGCGCGGCTGGGAGCGG - Intronic
1128547742 15:68579207-68579229 GCGGCGTGCGGGGGCGGCGGCGG - Exonic
1129644723 15:77419777-77419799 GCGGGGCGCGGGGGTGGCCGGGG + Intronic
1129761459 15:78131374-78131396 GAGGCGCGCGGGGGTCTCGGAGG + Exonic
1129761521 15:78131559-78131581 GGGGCGCGCGGGGGTCTCGGAGG + Intronic
1130531582 15:84750803-84750825 GAGGCCTGTGGGGCTGGAGGGGG + Intronic
1132453272 15:101980101-101980123 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1132453285 15:101980174-101980196 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1132453290 15:101980203-101980225 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1132558360 16:582538-582560 GAGGCGCCCTTGGCTGGCTGGGG + Intronic
1132585945 16:705805-705827 GAGGAGCGCGGGGAGGGCGAGGG - Exonic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1132592964 16:734360-734382 GGGGCACACGGGGCTGGCGGGGG + Intronic
1132623019 16:876716-876738 GAGGCGGGCTGGGCGGGCTGAGG + Intronic
1132626926 16:895607-895629 GGGGCTCGCGAGACTGGCGGGGG + Intronic
1132641812 16:981590-981612 GCGCCGGGCGGGGCAGGCGGGGG + Intergenic
1132641955 16:982048-982070 GGGCCGCGCGGGGGTCGCGGTGG + Exonic
1132671146 16:1102773-1102795 GAGGTGAGGGGGGCTGGGGGAGG - Intergenic
1132719760 16:1309850-1309872 GCGGGGCGCGGGGCAGTCGGGGG - Intronic
1132741274 16:1414517-1414539 GGGGGGCGCGGGGGCGGCGGAGG + Intronic
1132741358 16:1414810-1414832 GGGGGGCGCGGGGCTGGGGCGGG - Intergenic
1132741382 16:1414858-1414880 GCGGGGCGCGGGGCTGGGGCGGG - Intergenic
1132805044 16:1771464-1771486 GAGCCGCGCGGCGCGGGCCGGGG - Intronic
1132808928 16:1788424-1788446 GAGGGCCGCGGGTCTGGAGGTGG + Intronic
1132850000 16:2020626-2020648 GAGGCGCCACGGGCGGGCGGGGG - Exonic
1132875589 16:2135617-2135639 GTGGCTCGGGGCGCTGGCGGGGG - Exonic
1132932872 16:2467827-2467849 GAGGCGGGCGCCGCTGGGGGAGG - Intergenic
1133072252 16:3254413-3254435 GAGGCTGCAGGGGCTGGCGGGGG - Exonic
1133223129 16:4327762-4327784 GAAGCGCGCGGGGGCGGCCGCGG - Intronic
1133232151 16:4371949-4371971 GAGCCGGGCGGGGCAGGCCGCGG - Exonic
1133325137 16:4937401-4937423 GAGGCGCGCCGGGCCCGAGGAGG - Intronic
1134149830 16:11797051-11797073 GGCGCGCGCGGGGGGGGCGGGGG + Intronic
1134519397 16:14911736-14911758 GTGGCTCGGGGCGCTGGCGGGGG + Intronic
1134554536 16:15154492-15154514 GTGGCTCGGGGCGCTGGCGGGGG - Intergenic
1134707067 16:16310391-16310413 GTGGCTCGGGGCGCTGGCGGGGG + Intergenic
1134960473 16:18401733-18401755 GTGGCTCGGGGCGCTGGCGGGGG - Intergenic
1135607303 16:23835911-23835933 GAGGAGGGCGGGGCTGGCCCGGG + Intergenic
1136181293 16:28554232-28554254 GAGGGGGGCGGGGCTCGTGGGGG + Intronic
1136550491 16:30980008-30980030 TAGGCGCGGGGCGGTGGCGGCGG - Exonic
1136724804 16:32348995-32349017 GGGGCGCGCGGGGAGGGAGGGGG - Intergenic
1136843130 16:33555034-33555056 GGGGCGCGCGGGGAGGGAGGGGG - Intergenic
1136913945 16:34163716-34163738 GACGCGCGCCGGGTAGGCGGGGG - Intergenic
1137454788 16:48609993-48610015 GCGGCGCCGGGGGCCGGCGGCGG + Exonic
1137753564 16:50884344-50884366 GAGGCGGGATGGGCTGGGGGAGG + Intergenic
1137753573 16:50884363-50884385 GAGGCGGGATGGGCTGGGGGAGG + Intergenic
1137753582 16:50884382-50884404 GAGGCGGGATGGGCTGGGGGAGG + Intergenic
1137753591 16:50884401-50884423 GAGGCGGGATGGGCTGGGGGAGG + Intergenic
1138100731 16:54250188-54250210 GAAGGGCAGGGGGCTGGCGGTGG - Intronic
1138228992 16:55324245-55324267 GAGGCGCGTGGGGGAGGGGGAGG - Exonic
1138961798 16:62036643-62036665 GAGACGCGCGGGGCTTGCTCGGG - Exonic
1139390448 16:66604261-66604283 GAGGAGGGTGGGGCTGGCCGGGG + Exonic
1139478862 16:67217220-67217242 GAGGCGTGCGGAACTGGCAGAGG - Intronic
1139519479 16:67472378-67472400 GAGGAGCTGGGGGCTGGGGGAGG - Intronic
1139597878 16:67968676-67968698 GCGGCCCGGGGGGCGGGCGGAGG - Exonic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1139950149 16:70664574-70664596 CAGGCCCGCGGGGCTGGGGTGGG - Intronic
1140442573 16:74999083-74999105 GCGGCTGGCGGGGCCGGCGGCGG + Exonic
1140476411 16:75241522-75241544 GAGGCGAGCCTGGCTGGCGTGGG - Intronic
1141585022 16:85027980-85028002 GAGGGGCGCGGGGAGGGAGGAGG + Intronic
1141662320 16:85448107-85448129 GATGCGGGCAGGGCAGGCGGAGG - Intergenic
1141679913 16:85537933-85537955 GAGGCGAGCGTGGCTGGAGCAGG + Intergenic
1141989580 16:87602445-87602467 GGGGGGCGGGGGGCGGGCGGGGG + Intronic
1142114419 16:88348813-88348835 GAGGCCCCTGGGGCTGTCGGGGG + Intergenic
1142115375 16:88353521-88353543 GAGCCGCGAGAGGCTGGCGGAGG - Intergenic
1142120394 16:88383838-88383860 GGGGTGCGCGGGGCTGGGCGGGG - Intergenic
1142156183 16:88533812-88533834 GGGGCGCGCGGGCCGGGCCGGGG - Exonic
1142356231 16:89603484-89603506 GAGGCACTGGGGGCTGGAGGGGG + Intergenic
1142379041 16:89721486-89721508 GAGGCGGGCGGGGCGGGCCAGGG - Intronic
1203001626 16_KI270728v1_random:168760-168782 GGGGCGCGCGGGGAGGGAGGGGG + Intergenic
1203133229 16_KI270728v1_random:1705166-1705188 GGGGCGCGCGGGGAGGGAGGGGG + Intergenic
1203153295 16_KI270728v1_random:1855332-1855354 GGGGCGCGCGGGGAGGGAGGGGG - Intergenic
1142763871 17:2055503-2055525 CTGGCGGGCGGGGCTGGCAGGGG + Intronic
1142848249 17:2692303-2692325 GAGGCCTGCGGGGCAGCCGGCGG - Intronic
1143596248 17:7916008-7916030 GCGGCGCGCGGGGACGGCGGCGG - Intergenic
1143711001 17:8735365-8735387 GAGGGGCCCGGGGCGGGCCGGGG - Intronic
1144806602 17:17972131-17972153 GTGGCACCCGCGGCTGGCGGAGG + Intronic
1144825737 17:18104751-18104773 GAGGTGCCCTGGGCTGGGGGTGG + Intronic
1145414553 17:22703972-22703994 GGGGCGCGCGAGGCTGCCGCTGG + Intergenic
1145937981 17:28726276-28726298 GGGGCGCGGGCGGCTGGGGGCGG - Intronic
1146255982 17:31391772-31391794 AGGGCGCGCGGCGATGGCGGCGG + Exonic
1146655717 17:34633615-34633637 GAGGTGGGCGGGGCTGGAGAGGG + Intronic
1146909783 17:36641387-36641409 GAGGCGCGCTGTGGAGGCGGCGG - Intergenic
1147210616 17:38870652-38870674 GAAGCGCGGGGCGCTGGTGGAGG + Intronic
1147250779 17:39151520-39151542 GCGGTCCCCGGGGCTGGCGGAGG + Exonic
1147317372 17:39627372-39627394 ATGGCGCGCGGGGTGGGCGGTGG - Exonic
1147598855 17:41733831-41733853 GAGGGGCGGGGGGCTGCGGGAGG - Intronic
1147705323 17:42421906-42421928 GAAGCGGGCGGGGCTGGGCGGGG - Intronic
1147879819 17:43646287-43646309 AGGGGGCGCGGCGCTGGCGGCGG - Intronic
1147954291 17:44123701-44123723 AAGGCGGGGGGGGCTGGGGGGGG - Intronic
1147971601 17:44221230-44221252 GGGGCGCGCGGGGCTGGAGCCGG + Exonic
1147987587 17:44315344-44315366 GGGGCGGGCGGGCCGGGCGGGGG + Intronic
1148139191 17:45316629-45316651 CAGGCGGGCGGGCCTGGCGGCGG + Intronic
1148742732 17:49902018-49902040 CTGGCGCGCGGGGCAGGGGGCGG - Intergenic
1148970149 17:51472842-51472864 GAGGAGCCTGGGGCTGGTGGAGG + Intergenic
1149512590 17:57256161-57256183 GAGGCGCGGGGAGCTTGCTGCGG - Intronic
1149512833 17:57256900-57256922 GGGGCGCGCGGGAGAGGCGGGGG - Intronic
1149993957 17:61397302-61397324 GGGCCGCCCGGGGCTGGAGGGGG - Intergenic
1149995314 17:61403205-61403227 AAGGTGCGCGCGGCGGGCGGTGG + Exonic
1150108255 17:62478114-62478136 GCGACGCGCGGGGCTGGGGCGGG + Intronic
1150137607 17:62704187-62704209 GGGACGCGCGGGGCGGGCGGCGG + Intronic
1150250260 17:63700724-63700746 GCGGCCCACGAGGCTGGCGGCGG + Intronic
1150489041 17:65561772-65561794 GGGCCGCGGGGGGCTGGCAGGGG - Intronic
1150691957 17:67374870-67374892 GAGGCGGGAGGGGCTGGTGCAGG - Intergenic
1150904910 17:69327027-69327049 GAGGCGGGCGTCGCGGGCGGCGG - Intronic
1151354831 17:73552060-73552082 GAGGGGTGGGGGGCAGGCGGTGG - Intronic
1151660526 17:75515952-75515974 GAGGCGCTCGTGCCGGGCGGAGG + Intergenic
1151662404 17:75525754-75525776 GGAGCGAGCGGGGCCGGCGGCGG + Exonic
1151801809 17:76383537-76383559 GGGGCGGGTGGGGCCGGCGGGGG + Intronic
1152069875 17:78129123-78129145 GAGGCTTGCGGGGGCGGCGGGGG - Intronic
1152245468 17:79182825-79182847 GGGGCGCGCAGAGGTGGCGGCGG - Intronic
1152353884 17:79797623-79797645 GCGGCGCGGGCGGCTGGGGGAGG - Intronic
1152354290 17:79799226-79799248 GAGGCGGGCGGGACAGGCAGAGG - Intronic
1152722837 17:81931315-81931337 GAGGGGCGCGGGGCTGCCAAAGG - Intergenic
1152758974 17:82098500-82098522 GGGGCCCGCGGGGCGGGAGGCGG - Intergenic
1152771578 17:82172929-82172951 GAGGGGCGCGGGGAGAGCGGAGG - Intronic
1152831004 17:82497047-82497069 CCGGCGCGCGCGGCTGGCGCTGG - Intergenic
1152861342 17:82698386-82698408 GAGGGGCGCGGGGCTGGGGAGGG - Intronic
1153051987 18:908416-908438 GGGGCGCGCGGGGCGGGCGGCGG + Intronic
1153075548 18:1157891-1157913 GAGGGGTGGGGGGCTGGGGGAGG - Intergenic
1153448232 18:5197148-5197170 AGGGCGCGCTGGGCGGGCGGCGG + Exonic
1153480690 18:5543661-5543683 GCGGCGGGCGGAGCGGGCGGGGG + Intronic
1153565676 18:6414962-6414984 CATGCGCGCGGGGCGGGCAGGGG - Intronic
1153900636 18:9614561-9614583 GACGCGCGCGGGAGGGGCGGCGG + Intronic
1153900649 18:9614588-9614610 GAGGAGGGCCGGGCTGGCGGGGG + Intronic
1155003009 18:21704677-21704699 GCGGCGCGCGGGTCCTGCGGCGG + Exonic
1155071869 18:22324289-22324311 GAGGGGCGCGCAGCTTGCGGCGG + Intergenic
1155209342 18:23586988-23587010 GCGGAGCGCGGGGTGGGCGGTGG + Intergenic
1155519846 18:26656898-26656920 GAGGGGCTCGGGGAGGGCGGGGG + Intronic
1156149144 18:34223027-34223049 GAGGTCCGCGGGGGAGGCGGCGG - Exonic
1156275807 18:35581747-35581769 GAGGAGCGCGCGGCGGACGGCGG + Intronic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1156463782 18:37336137-37336159 GAGGCTCCTGGGGCTGGCTGTGG - Intronic
1156488924 18:37485223-37485245 GCGGCCCGCGGGCCCGGCGGAGG + Intronic
1157529510 18:48409438-48409460 GCGGGGCGCGGGGAGGGCGGAGG - Intronic
1157529587 18:48409682-48409704 GGGGCGCCCGGGACTGGCGGAGG + Intronic
1159586606 18:70288852-70288874 GGGGCGCGCGGGGCTGAGGCCGG - Intergenic
1160163269 18:76491403-76491425 GGGGCGGGCGGGGCGGGCGGGGG - Intronic
1160186793 18:76682128-76682150 GGGGCGCCAGGGGCTGGGGGAGG - Intergenic
1160206416 18:76837131-76837153 GAGGCTTGCGGGGCGGGGGGGGG - Intronic
1160518868 18:79493323-79493345 GAGGCGCTCGGGGCCCGCTGCGG + Intronic
1160613949 18:80109698-80109720 GCGGCGGGCGGGGCGGGCCGCGG - Intronic
1160680304 19:409068-409090 CAGGCTCCCGGGGCTGGCGCGGG + Exonic
1160690979 19:460661-460683 GGGGGTCGCGGGGCGGGCGGGGG - Exonic
1160745332 19:708779-708801 GGGGCGCGCGGGGCGGGGGGCGG + Intergenic
1160784399 19:892819-892841 GAGGCCCGCGGGGCTGGGTTCGG - Intronic
1160826392 19:1082380-1082402 GACAAGTGCGGGGCTGGCGGTGG + Intronic
1160865444 19:1253969-1253991 GGGCCGGGCCGGGCTGGCGGAGG + Intronic
1160913771 19:1487366-1487388 GAGTGGCGCGGGGCGGGCTGGGG - Intronic
1160937820 19:1605485-1605507 CACGCGCGCGGGGAGGGCGGGGG + Exonic
1160948137 19:1652705-1652727 GAGCCGCCCGGAGGTGGCGGAGG - Intergenic
1160983640 19:1827716-1827738 GAGGCGGGCTTGGCTGGGGGCGG + Exonic
1160991980 19:1863777-1863799 GAGCCGCGCGCGGCCGCCGGGGG + Intergenic
1160999951 19:1905565-1905587 GACGCGCGCGAGGCTGGCCTGGG - Intronic
1161095002 19:2385155-2385177 GCGGAGGGCGGGGCTCGCGGGGG + Intergenic
1161095010 19:2385171-2385193 GCGGGGGGCGGGGCTCGCGGGGG + Intergenic
1161150083 19:2702816-2702838 GCGGGGCGCGGGGCAGGCAGCGG + Intergenic
1161157315 19:2739394-2739416 GAGGCGCTTGGGGCTGATGGTGG - Intronic
1161203616 19:3029119-3029141 GGGGCGAGCGGGGCGGGCAGGGG + Exonic
1161311378 19:3595965-3595987 GGGGCGGGCGGGGCTGGAGGCGG - Intronic
1161581100 19:5081530-5081552 GAGGCGTGCGTGGCTGGGGTGGG - Intronic
1161582087 19:5086647-5086669 GAGGCCCTGGGGGCTGGGGGGGG - Intronic
1161595074 19:5147041-5147063 GAGGCTCCCGGGGCAGGCGGAGG - Intronic
1161925239 19:7294494-7294516 GAGGCGGGCGGGGCGGGGCGGGG - Intergenic
1162135013 19:8550140-8550162 GAGGCGAGTGGGGCTGGGGCTGG - Exonic
1162363149 19:10231363-10231385 GAGGAGGGCGGGGCGAGCGGGGG - Intergenic
1162462206 19:10819876-10819898 GAAGCCCCCGGGGCTGGTGGTGG + Intronic
1162769997 19:12943658-12943680 GGGGCGGGCAGGGCTGGCAGGGG + Intronic
1162967207 19:14161571-14161593 GAGGGGCGTGGGCCTGGCTGTGG + Exonic
1162975844 19:14206659-14206681 GGGCGGCGCGGAGCTGGCGGAGG + Intergenic
1163023434 19:14495894-14495916 GCTGCGCGCGGGGATGCCGGAGG - Intronic
1163282428 19:16325693-16325715 GAGGCGCGCGGACCGGGCGCGGG - Exonic
1163453248 19:17391260-17391282 GCGGCGCGCAGGCGTGGCGGAGG - Intergenic
1163631323 19:18419366-18419388 GGGGCGCGCGCGGCGGGAGGAGG + Exonic
1163720577 19:18896388-18896410 GGGGCGCGCGGGGCAGGCATGGG - Intronic
1163786431 19:19277234-19277256 GAGACCCCCGGGGCGGGCGGGGG + Intronic
1163939132 19:20476861-20476883 GAGGCGGGAGGGACTGGAGGAGG + Intergenic
1164693128 19:30225726-30225748 GCGGCGCGGGGGGGCGGCGGCGG + Intergenic
1165157217 19:33796038-33796060 GCGGCGCCCGGGGCTGGGGGCGG - Intronic
1165366759 19:35372022-35372044 GAGGGTGGCGGGGCTGGTGGCGG + Exonic
1165448200 19:35868394-35868416 GAGGGGCGGGGGCCTGGCGCAGG + Intronic
1165461099 19:35944912-35944934 GGGGCGGGCGGGGCGGGCGTGGG - Exonic
1165470313 19:35999624-35999646 GTGGCGAGCGGGGTTGGGGGCGG - Intergenic
1165925010 19:39321109-39321131 GAGGCCGGCGGGGCTGGGGGTGG - Intergenic
1166045296 19:40226440-40226462 GAGGCCGCCGGGGCTGGAGGAGG - Exonic
1166094192 19:40529453-40529475 GAGAGGGGCGGGGCGGGCGGTGG + Intronic
1166791705 19:45402631-45402653 GCGGGGCGCGGGGGTGGCGCGGG + Intronic
1166809186 19:45505757-45505779 GAGCCGGGCGGGCCTGGCTGGGG + Intergenic
1166837603 19:45677127-45677149 GAGGCGCGCTGGGTTGGGCGGGG - Intronic
1166876641 19:45901836-45901858 AGGGCGCACGGGGCTGGCTGGGG + Intronic
1167019184 19:46861346-46861368 GGGGCCCGGGGGGCTGGGGGGGG - Intergenic
1167134528 19:47608988-47609010 GGGGCGCGCGGGCCTGGGCGCGG + Intronic
1167557064 19:50203353-50203375 GAGGCGCGGGGGGCGGCCGGGGG - Intronic
1167564381 19:50247120-50247142 CAGGTAGGCGGGGCTGGCGGTGG + Exonic
1167578346 19:50328382-50328404 GAGGCGGGCGCGGGCGGCGGCGG - Exonic
1167630804 19:50625368-50625390 GAGGGGCGCGGCCCGGGCGGGGG - Intronic
1167689164 19:50975007-50975029 GAGGGAGGAGGGGCTGGCGGCGG + Intergenic
1167689210 19:50975134-50975156 GAGGGAGGAGGGGCTGGCGGGGG + Intergenic
1167859240 19:52269878-52269900 ACGTGGCGCGGGGCTGGCGGAGG - Intronic
1168235947 19:55063184-55063206 GAGGGGCGGGGCGCGGGCGGAGG + Intronic
1168309048 19:55451646-55451668 GAGACGGGCGGGGGAGGCGGGGG - Intergenic
1168315344 19:55482511-55482533 GGGGCGGACGGGGGTGGCGGCGG - Exonic
1168343747 19:55640852-55640874 GAGGGGAGCGGGGCCGCCGGGGG + Intronic
1168408033 19:56120911-56120933 GCGGCGAGCGGGGCTGGAGGGGG - Intronic
1168495015 19:56840550-56840572 GAGGCGCGCGGGGCGGCCGAAGG + Intronic
925068597 2:950065-950087 GGGGCGCACGGGGCTGGGGCGGG - Intergenic
925376284 2:3388354-3388376 GAGGGGAGGCGGGCTGGCGGGGG - Exonic
925590845 2:5507820-5507842 GAGATGCCCGGGGCTGGGGGTGG + Intergenic
925927203 2:8678983-8679005 GCGGCGCGCGGGCCAGGCCGCGG - Exonic
926077257 2:9951514-9951536 GAGCGGCGCGGGGCGGGGGGCGG - Intergenic
926154940 2:10448434-10448456 GAGGGGCGGGGGCCCGGCGGTGG + Exonic
926216950 2:10911788-10911810 GCGGTGCGCGGTGGTGGCGGCGG + Intergenic
927641422 2:24847966-24847988 GAGGCTCGCGGGGCAGGAGGAGG + Intronic
927718652 2:25368876-25368898 GAGGCGCGCTGGCTTGGAGGAGG + Intergenic
927945879 2:27134801-27134823 GGGGCGCGGGGCGCGGGCGGAGG + Intergenic
927982061 2:27380532-27380554 GAGGCGCGTCGGGCTGGAGCCGG - Exonic
928512000 2:32010744-32010766 GAGCGGGGCGGGGCCGGCGGCGG - Intronic
929133645 2:38602652-38602674 CAGGCGGGTGGGGGTGGCGGTGG + Exonic
929248443 2:39727708-39727730 GAGGGGTGGGGGGCTGGGGGAGG - Intergenic
931222224 2:60297901-60297923 GAGGGAGGCGGGGCTTGCGGGGG + Intergenic
932599258 2:73112744-73112766 GCGGGGCGCGGAGCCGGCGGCGG - Exonic
932763743 2:74457557-74457579 GGGGCGCACGGGGCGAGCGGCGG + Exonic
932773602 2:74514683-74514705 GGGGCCCGCGGGGCTGGCCAAGG - Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
933945642 2:87283968-87283990 CAGGCGAGCTGGGCTGGCTGTGG + Intergenic
934079023 2:88452180-88452202 GAGGCGGGCGCGGCGGGCGCGGG + Exonic
934180085 2:89612054-89612076 GAGGCGCGGGGGGCGGGACGCGG - Intergenic
934290376 2:91686314-91686336 GAGGCGCGGGGGGCGGGACGCGG - Intergenic
935046636 2:99489521-99489543 GCGGCCCATGGGGCTGGCGGCGG + Intronic
935275800 2:101474396-101474418 GGGGCGCGCGGGGCGCGGGGCGG + Intronic
935301566 2:101697756-101697778 GAGGCGCGCGGCGCGGGGCGCGG + Intronic
935592545 2:104855583-104855605 GACGCGGCAGGGGCTGGCGGCGG + Exonic
935592699 2:104856106-104856128 GAGGTGCGCGGCGGCGGCGGCGG - Exonic
936334570 2:111577619-111577641 CAGGCGAGCTGGGCTGGCTGTGG - Intergenic
936569407 2:113602197-113602219 GAGGCGCGCCGCGCCGGCGCCGG - Intergenic
937119458 2:119431779-119431801 GAGGCGGGCGGGGCGGGAGGGGG - Intronic
937915321 2:127096099-127096121 GAGGGGCACAGGGCTGGGGGTGG - Intronic
937991281 2:127663819-127663841 GAGGGGCACGGGGATGGTGGTGG - Intronic
938034705 2:128027105-128027127 GAAGCGGGCGGTGCGGGCGGCGG - Exonic
939990892 2:148875945-148875967 GGGCCGGGCGGGGGTGGCGGGGG + Intronic
940918921 2:159286656-159286678 GAGGCTGGCGGGGCGGGCGCCGG + Intronic
942538850 2:176994521-176994543 GAGGGGTGGGGGGCTGGGGGAGG + Intergenic
942678190 2:178450742-178450764 GCGGCGCGCGGGGCGGGCGGAGG - Intronic
943669839 2:190648992-190649014 GAGGCGGGCGGGGGAGGGGGAGG + Intronic
944645900 2:201780885-201780907 GCGGAGCGCGGTGCTGCCGGTGG - Exonic
944743854 2:202636003-202636025 GAGCCGTGCGGGGCGGGCAGAGG - Intronic
946163067 2:217847794-217847816 GAGGCCCGTGGGGCTGGCTCAGG + Exonic
946409947 2:219510915-219510937 GAGGGGCGGGGGGCGGACGGCGG - Intergenic
947472472 2:230411997-230412019 GAGGAGCGCGGGGCGGCCGCGGG + Intergenic
947514900 2:230794676-230794698 GAGGTGGGCGGGGCTTCCGGTGG - Intronic
947741754 2:232487907-232487929 GGGGCGCGCGGGGCGGGCGGAGG - Intergenic
947786442 2:232825846-232825868 GAGGGGTGGGGGGCTGGGGGAGG - Intronic
948415388 2:237799025-237799047 GAGGCCAGCGAGGCGGGCGGGGG + Intronic
948645301 2:239400631-239400653 GCGGGGCGCGGGGCGGGCGGCGG + Exonic
948801377 2:240435135-240435157 GAGGCGCGGCCGGCGGGCGGAGG + Intergenic
948801628 2:240435879-240435901 GAGGCGCGGGCGGGTGGCCGGGG + Exonic
948874811 2:240820669-240820691 GGGGCGGGCGGGGCTGGGGAGGG + Intergenic
948910301 2:240999229-240999251 GAGGCGCGCGGGCGGGGCGGGGG + Intronic
949088915 2:242182564-242182586 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
949088922 2:242182593-242182615 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
949088929 2:242182622-242182644 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
949088936 2:242182651-242182673 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
949088943 2:242182680-242182702 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
949088950 2:242182709-242182731 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
949088957 2:242182738-242182760 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
1168804424 20:664156-664178 GGGGCGCGCGGGGCGCGCGGGGG - Exonic
1168951157 20:1803201-1803223 GAGGGGCGCGTGGCTCGCAGAGG - Intergenic
1169164113 20:3407680-3407702 GCGGCGCGCGGGCCCGGCGGGGG + Intergenic
1170021537 20:11841770-11841792 CAGGCGTGGGGGGCTGGGGGAGG - Intergenic
1170150469 20:13221619-13221641 CGGGCCCGCGGGGCTGGCGCTGG - Intergenic
1170890040 20:20368700-20368722 GGCGCGAGCGGAGCTGGCGGAGG + Exonic
1170999299 20:21396924-21396946 CAGGAGCGCGGGGCTGCGGGCGG - Intronic
1171223238 20:23420568-23420590 GAGGCGCGCCGGGGTGGAGCCGG - Intronic
1171810129 20:29740885-29740907 GATGCGCGCCCGGCAGGCGGGGG + Intergenic
1171849814 20:30300408-30300430 GACCCGGGCGGGGCGGGCGGCGG - Intergenic
1172100779 20:32483238-32483260 GGGGGGCGAGGGGCTGGGGGCGG - Intronic
1172275007 20:33674517-33674539 GAGGCCCGCGGCGCTGGAGTTGG - Intergenic
1172644477 20:36461388-36461410 GACGCGCGCGCGGCTGACGCGGG + Intronic
1172793438 20:37521535-37521557 GGGGCGCGCGGTGCCGGCAGCGG - Intronic
1173251672 20:41366908-41366930 CTGGGGCGAGGGGCTGGCGGCGG - Intergenic
1173649103 20:44651741-44651763 GCGGCGGGCGGGGCGGGAGGCGG - Exonic
1173672863 20:44810273-44810295 GAGGCGCCCGGCGCCGGCGCGGG - Intronic
1173672929 20:44810475-44810497 GAGGCGCGCTGTGCTGCTGGCGG + Intergenic
1173852720 20:46228888-46228910 GAGGCGGGAGAGGCGGGCGGCGG - Intronic
1175256818 20:57652712-57652734 GAGGGCAGCAGGGCTGGCGGGGG + Intronic
1175714650 20:61247332-61247354 GAGGCGGGCGGGGTGGGGGGGGG + Intergenic
1175715928 20:61253824-61253846 GCAGCGCGCGGAGCTGGAGGAGG + Intronic
1175750726 20:61495397-61495419 GATAAGCGGGGGGCTGGCGGCGG - Intronic
1175834497 20:61984933-61984955 GAGGAGGGCAGGGGTGGCGGGGG + Intronic
1175884523 20:62281684-62281706 GAGGCCCCTGGGGCAGGCGGGGG - Intronic
1175980067 20:62734216-62734238 GGGGCGTGAGGGGCGGGCGGAGG + Intronic
1175994118 20:62804784-62804806 GAAGCGCGGGGGGCGGGCGGGGG - Intergenic
1176005627 20:62861057-62861079 GGGCCGCGCGGCGCGGGCGGCGG + Exonic
1176039472 20:63056636-63056658 GGGGCTGGCGGGGCTGGCAGTGG + Intergenic
1176097100 20:63349228-63349250 GAGGCCCGCGGGGCAGGCACAGG + Intronic
1176107406 20:63395883-63395905 GAGGCGGCCGGGGCTGCAGGAGG + Intergenic
1176156927 20:63626760-63626782 CAGGCGGGCGGCGCGGGCGGTGG - Intronic
1176194390 20:63830815-63830837 GGGGCGCGCGGGGGCGGCGCGGG - Intronic
1176257662 20:64160562-64160584 GGGACGCGAGGGGCTGGGGGTGG - Intronic
1176549740 21:8216067-8216089 GAGGCGTGGGGGGGGGGCGGGGG - Intergenic
1176557631 21:8260296-8260318 GAGGCGTGGGGGGGGGGCGGGGG - Intergenic
1176568665 21:8399101-8399123 GAGGCGTGGGGGGGGGGCGGGGG - Intergenic
1176706009 21:10120354-10120376 GAGGCGCACGGCGCCGGCGCAGG + Intergenic
1177431702 21:20998291-20998313 GAGCCGGGCGGGGAGGGCGGCGG - Intergenic
1178488463 21:33033241-33033263 TGGGCGCGCGGCGCGGGCGGAGG + Intergenic
1178673971 21:34615179-34615201 GTGACGGGCGGGGCTGGCGCTGG - Intergenic
1179430247 21:41316693-41316715 CAGGTGCGCGGGGCGGGCGTGGG - Intronic
1179433731 21:41345184-41345206 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179433745 21:41345230-41345252 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179433759 21:41345276-41345298 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179433773 21:41345322-41345344 GAGGCGGGTGGGCCTGGCTGAGG + Intronic
1179674812 21:42974367-42974389 GGTGCGGGCGGGGCTGGAGGCGG + Intergenic
1179783876 21:43719073-43719095 GCGGCGCCGGGGGCTGGCCGGGG - Intronic
1179788110 21:43741147-43741169 CAGGGGCGGGGGGCTCGCGGGGG + Intronic
1179788211 21:43741355-43741377 GGCTCGCGGGGGGCTGGCGGGGG + Intronic
1180264214 21:46699281-46699303 GAGGCGCGGCGCGCCGGCGGAGG - Intergenic
1180614940 22:17120795-17120817 GACAGGCGCGGGGCCGGCGGGGG + Exonic
1180797143 22:18611497-18611519 GGGGCGCGCCGGGCGGTCGGCGG - Exonic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1181128246 22:20714184-20714206 GAGGGGCCCGGGGCTGTTGGGGG - Intronic
1181224580 22:21383774-21383796 GGGGCGCGCCGGGCGGTCGGCGG + Exonic
1181230248 22:21417585-21417607 GGGGCGCGGGGAGCGGGCGGGGG + Intronic
1181241571 22:21479489-21479511 GAGGGGCCCGGGGCTGTTGGGGG - Intergenic
1181254052 22:21551039-21551061 GGGGCGCGCCGGGCGGTCGGCGG - Exonic
1181283532 22:21736166-21736188 TCGGCCGGCGGGGCTGGCGGTGG + Intergenic
1182092040 22:27602537-27602559 GAGGTGGGCGGGGCTGGGGTGGG + Intergenic
1183149744 22:36028416-36028438 GGGGCGCGGGCGGATGGCGGAGG - Exonic
1183358775 22:37372756-37372778 CAGGGCCGGGGGGCTGGCGGGGG - Exonic
1183441405 22:37825062-37825084 GGGGCGCGCCATGCTGGCGGTGG + Exonic
1184037700 22:41926403-41926425 GAGGGGGGCGAGGCTGGCCGGGG + Intronic
1184101456 22:42343631-42343653 GGGGCGCGCGGGGCCCGCGCTGG - Intergenic
1184101597 22:42343998-42344020 GCGGCGCGCCGGGCTGGGGTAGG + Intergenic
1184236772 22:43187183-43187205 GAGGAGGGCGGGGCGGGGGGGGG - Intergenic
1184236788 22:43187210-43187232 GAGGAGGGCGGGGCGGGGGGGGG - Intergenic
1184236804 22:43187237-43187259 GAGGAGGGCGGGGCGGGGGGGGG - Intergenic
1184236828 22:43187276-43187298 GAGGCGGGCGGGGCGGGGGGCGG - Intergenic
1184361975 22:44024315-44024337 GCCGCGCGTGGGGCCGGCGGCGG - Intronic
1184663380 22:45975778-45975800 GAGGAGCGCGGGGCCAGCAGCGG + Intronic
1184766249 22:46573987-46574009 GAGGAGCAGGGAGCTGGCGGTGG + Intergenic
1185055441 22:48576347-48576369 GCGGAGCGCGGCGTTGGCGGCGG + Intronic
1185195348 22:49466001-49466023 GTGGGGTGCGGGGCTGGGGGAGG - Intronic
1185258645 22:49849716-49849738 GAGGCGCTCGGGGTTGGGGAGGG - Intergenic
1185369714 22:50455454-50455476 GTGGCGCGTGGGGCTGGGGTGGG - Intronic
1185387783 22:50544245-50544267 GGGGCCGGCGGGGCTGGCGCTGG + Intergenic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
949089487 3:10999-11021 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089492 3:11028-11050 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089497 3:11057-11079 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089502 3:11086-11108 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089507 3:11115-11137 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089512 3:11144-11166 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089517 3:11173-11195 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089522 3:11202-11224 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089527 3:11231-11253 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089532 3:11260-11282 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089537 3:11289-11311 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089542 3:11318-11340 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089547 3:11347-11369 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089552 3:11376-11398 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089557 3:11405-11427 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089567 3:11463-11485 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089572 3:11492-11514 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089577 3:11521-11543 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089582 3:11550-11572 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089587 3:11579-11601 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089592 3:11608-11630 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089597 3:11637-11659 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089602 3:11666-11688 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089607 3:11695-11717 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949089612 3:11724-11746 GAGGCGCGCGGCGCCGGCGCAGG + Intergenic
949938612 3:9136414-9136436 GTGGCGCGCGGGGCGGGGCGGGG - Intronic
950153736 3:10707683-10707705 GCGGCGGGCGGGGCGGGCCGGGG - Intronic
950438389 3:12993890-12993912 GGGGCGCGCGGGGATCGCGGCGG - Intronic
950453203 3:13077338-13077360 GAGGAGGGCAGGGCTGGCGAGGG - Intergenic
950473285 3:13199587-13199609 GAGGGTCGCGGGGCTGGCCTTGG - Intergenic
950477285 3:13222146-13222168 GAGGTGCCAGGGGCTGGGGGAGG - Intergenic
950569344 3:13790602-13790624 GTGGAGGGCGGGGCTGGAGGTGG - Intergenic
950583999 3:13880144-13880166 GAGGCGGGCGGGGGAGGGGGCGG - Intergenic
950637209 3:14323626-14323648 GAGGCAGGCGGGGCTGGTGAGGG + Intergenic
950911958 3:16604776-16604798 GAGGCGCGTGGGAGTGGGGGAGG + Exonic
952816727 3:37452919-37452941 GAGGCTCGCTGGGCCAGCGGCGG - Intronic
953246680 3:41199740-41199762 CAGGCGCGCGGTCCGGGCGGCGG + Intronic
953614418 3:44477556-44477578 GCGGGGCGCGGGGGTGGGGGTGG - Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
953881536 3:46693725-46693747 GAAGGGGGCGGGGCTGGCAGGGG - Intergenic
954028604 3:47802733-47802755 GAGGCGCGGGTGGCTCGCAGAGG + Intergenic
954146423 3:48636531-48636553 GAGGGCCGCTGGGCTGGAGGAGG + Exonic
954313219 3:49786297-49786319 GACGCCCGCGGGGAGGGCGGTGG - Intronic
954391283 3:50269311-50269333 AAGGCGTGGGGGGCTGGGGGCGG - Exonic
954779091 3:53046108-53046130 GAGGACCGCGGAGCTGGGGGTGG - Intronic
954912772 3:54122639-54122661 GAGCTGCGCGGAGCGGGCGGTGG - Intronic
955188014 3:56733318-56733340 GAGGTGGGCGGGGCGGGGGGGGG + Intronic
955687410 3:61561490-61561512 GGGGCGCGCGGTGGCGGCGGGGG - Intergenic
956675074 3:71725444-71725466 GGGGCGCGCGGGGCGGGGCGGGG - Intronic
956761331 3:72447307-72447329 GGGGCGCGCGTGCCTGTCGGTGG + Intergenic
958814677 3:98901959-98901981 CAGGCGCCCGGGCCGGGCGGGGG - Intergenic
959193219 3:103142225-103142247 GGGGCGTGCGGGGCTAGGGGAGG + Intergenic
960624207 3:119664570-119664592 GAGGCAGGCGAGGCAGGCGGGGG + Intronic
960848003 3:122022281-122022303 GCGGCGCGCGGGGCGGGAGGCGG - Intergenic
961525064 3:127491479-127491501 GAGTCGCCAGGGGCTGGGGGTGG + Intergenic
961735935 3:129002174-129002196 CAGGCGCGCAGGGCGGGCGGCGG - Exonic
961827472 3:129606571-129606593 GAACGGCGGGGGGCTGGCGGCGG + Exonic
963888123 3:150603518-150603540 GAGGCGCGGCGGGGTGGCCGGGG - Intronic
964819768 3:160756265-160756287 GGGGCGCGCGTCGCTGGTGGTGG + Exonic
965962130 3:174441219-174441241 GAGGGGCGCCCGGCCGGCGGCGG + Intronic
966182122 3:177197281-177197303 GATGGGCGCCGGGCGGGCGGGGG + Intronic
966182155 3:177197368-177197390 GGGGCGCACGCGGCCGGCGGCGG + Intronic
966182197 3:177197557-177197579 GAGGCCCGCGGCGGCGGCGGCGG + Intergenic
966866542 3:184261513-184261535 GCGGGGGGCGGGGGTGGCGGCGG + Intronic
967330949 3:188288823-188288845 GAGGGGCGGGGGGGTGGGGGTGG - Intronic
967945243 3:194798924-194798946 GAGGCACCTGGGGCTGGCTGAGG + Intergenic
968136038 3:196220153-196220175 GCTGCGCGCCGGGCTGGCGGAGG + Intronic
968276205 3:197442255-197442277 GAGGCAAGAGGGGCTGGTGGAGG + Intergenic
968433821 4:575199-575221 GGGGCCGGCGGGGCCGGCGGGGG - Intergenic
968434175 4:576370-576392 GAGGCGCGCGGGGCCGCGGGCGG - Intergenic
968514189 4:1009595-1009617 GAGGGGCGGGGGGCTGCCTGAGG + Intergenic
968515155 4:1012597-1012619 GAAGGGGGCGGCGCTGGCGGAGG - Intronic
968556759 4:1249562-1249584 GAGGCGCACGGGCCAGGCCGCGG - Intronic
968583017 4:1403623-1403645 GAGGCGCGGGGAGGCGGCGGCGG - Exonic
968606456 4:1537960-1537982 AAGGCACGCTGGGCTGGAGGGGG - Intergenic
968612085 4:1561860-1561882 GAGGCCGGTGGGGCCGGCGGCGG - Intergenic
968701411 4:2059712-2059734 GGGGGGCGCGGGGCCGCCGGGGG + Exonic
968908047 4:3463549-3463571 CAGGTGAGCGGGGCGGGCGGGGG + Exonic
968942903 4:3648406-3648428 GAGGCGGGCGGGGTCGGGGGTGG - Intergenic
969040288 4:4290373-4290395 AAGGCGTGCGGGGCTGGCGCTGG + Intronic
969344859 4:6564019-6564041 GAGGCGCGGGGTGCGGGCGCGGG + Intergenic
969689380 4:8695875-8695897 GGGGCGGGCAGGGCAGGCGGGGG + Intergenic
969717072 4:8872913-8872935 GAGGGGCCCGGGGCTGGCCCTGG - Intergenic
970243398 4:14032819-14032841 GAGGAGGGCAGGGCTGGCTGGGG - Intergenic
973317764 4:48779787-48779809 CGGGCGCGCGGCGCTGCCGGCGG + Intronic
973619517 4:52712693-52712715 GCGGCCCGGGGGGCGGGCGGCGG + Intergenic
973884098 4:55303125-55303147 GGGGCGTGAGGGGCTGGGGGAGG + Intergenic
975118418 4:70704673-70704695 GGGGCGGGAGGGGCTGGAGGAGG + Intronic
975584849 4:75939956-75939978 GAGTAACGCGGGGCTTGCGGGGG - Intronic
975622042 4:76306108-76306130 TAAGCGCGCTGAGCTGGCGGCGG + Intronic
976299811 4:83507023-83507045 GAGGCGGGAGGGACTGGAGGAGG + Intronic
977716647 4:100190544-100190566 GAGGGGCGGGGCGCTGGCCGGGG - Intronic
977809814 4:101346464-101346486 GAGCCGCGGGGAGGTGGCGGCGG - Intronic
977886097 4:102253160-102253182 GGGGCGAGCGGGGAGGGCGGCGG + Intronic
978620143 4:110629392-110629414 GAGGCGCGGGGGCGGGGCGGCGG + Intronic
979468941 4:121072367-121072389 GCGACCCGCGGGGCTGGCGCGGG + Exonic
979829504 4:125281888-125281910 GGGGCGCGGGGGGGGGGCGGGGG + Intergenic
981081837 4:140644433-140644455 GACGCGCGGGGCGATGGCGGCGG + Intronic
981128531 4:141133066-141133088 AGGGCCCGCGGGGCTTGCGGAGG + Intronic
983537863 4:168877790-168877812 GCGCTGCGCGGGGCTGGCGGAGG - Intronic
984699247 4:182807903-182807925 GAGGCGCTCGCTGCTGCCGGTGG - Intergenic
984934014 4:184874173-184874195 GAGGCCCCCCGGGCTGGTGGAGG - Intergenic
984999741 4:185471437-185471459 AGGGCGCGCTGGGCGGGCGGCGG + Intronic
985466754 4:190203829-190203851 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
985466761 4:190203858-190203880 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
985466768 4:190203887-190203909 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
985466775 4:190203916-190203938 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
985466782 4:190203945-190203967 GAGGCGCGGGGCGCCGGCGCAGG - Intergenic
985467609 5:12489-12511 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467614 5:12518-12540 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467619 5:12547-12569 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467624 5:12576-12598 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467629 5:12605-12627 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467634 5:12634-12656 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467639 5:12663-12685 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467644 5:12692-12714 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467649 5:12721-12743 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467654 5:12750-12772 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467659 5:12779-12801 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985467664 5:12808-12830 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
985478845 5:94584-94606 GTGGCTGGCGGGGCTGGAGGGGG + Intergenic
985495047 5:199561-199583 GAGGGGCTCTGGGCTGGCAGAGG - Exonic
985936523 5:3101790-3101812 GAGGCTCCAGGGGCTGGGGGAGG - Intergenic
987050848 5:14145035-14145057 GAGGCGGGCGGGGGTGCTGGTGG + Intronic
987385719 5:17327307-17327329 GAGGCGGGGGGGGCTGGGGTGGG + Intergenic
989812609 5:45695991-45696013 GACGGGCGCGGGGCCGGCCGCGG - Exonic
990185315 5:53204463-53204485 GAGGCGGGAGGGACTGGAGGAGG - Intergenic
990509960 5:56481130-56481152 CGGGCGCGCGGGGCTGGGGGCGG - Intronic
991073131 5:62508741-62508763 GAGTGGTGCGGGGCTGGGGGAGG - Intronic
992365440 5:76084678-76084700 GACCCGCGAGGGGCGGGCGGGGG + Intronic
992627578 5:78648924-78648946 GCGGCGCGCGGGGCGGGACGGGG + Intronic
993655765 5:90576255-90576277 GTGGGGCGGGGGGCTGGGGGAGG - Intronic
994197549 5:96936335-96936357 GAGGTTCGGGGGGCGGGCGGCGG + Intronic
995224654 5:109689637-109689659 GAGGCGCAGGGGGCGGGCGGCGG - Exonic
995224783 5:109690090-109690112 AGGGCGCGCGGGGCAGGCGGAGG - Exonic
995650364 5:114362185-114362207 GAGGAGCGCGGCGGCGGCGGCGG - Exonic
995650462 5:114362633-114362655 GCTGCCCGTGGGGCTGGCGGCGG - Exonic
997305027 5:132830516-132830538 GAGGCCGGCGGGGCTGCGGGCGG - Intronic
998143273 5:139711456-139711478 GGGGTGCGCGGGGCGGGGGGAGG + Intergenic
998658118 5:144205196-144205218 CAGGCGCGCGGGGCTTGGGGCGG - Intronic
999232480 5:150069820-150069842 CAGGGGCGGGGGGCGGGCGGGGG + Intronic
999322670 5:150624914-150624936 GAGGGGCGCTGGCCTGGCAGGGG + Intronic
1000052659 5:157575836-157575858 GAGGCCCGCGGGGCTGGAGGCGG - Intergenic
1001056924 5:168457447-168457469 GAGACACGCGGAGCTGGCTGTGG - Intronic
1001653214 5:173329629-173329651 GGGGCTCGCAGGGCTGGGGGAGG + Intergenic
1001928808 5:175658346-175658368 GAGGCTCGCAGGCCAGGCGGAGG - Intronic
1002487771 5:179551061-179551083 CAGGCACGCGGGGCTGCGGGGGG - Intronic
1003175888 6:3751955-3751977 GAGGCGCGGGGGGCGCGAGGCGG - Exonic
1003212265 6:4078897-4078919 GAGGCGCTCGGGCCTCGGGGCGG - Exonic
1004716688 6:18223331-18223353 GGGGGGCGGGGGGCGGGCGGTGG - Exonic
1005040334 6:21595141-21595163 GTGGCGGGCGGCGCGGGCGGTGG + Exonic
1006177328 6:32130224-32130246 GAGGGGCGCGGTGCGGGAGGCGG + Exonic
1006180723 6:32151960-32151982 GGGGCGGGGGGGGCGGGCGGAGG + Intronic
1006654254 6:35576674-35576696 GGGGCCCGGGGGGCGGGCGGGGG + Intronic
1006834044 6:36986130-36986152 GTGGCGCCCTGGGCTCGCGGCGG - Exonic
1007424020 6:41735372-41735394 GAGCCGCGGGGCGCGGGCGGCGG - Intronic
1007451303 6:41941721-41941743 GCGGGGCGCGGGTCTGGCGCTGG + Exonic
1007785105 6:44275378-44275400 GCGGCGCGGGGGGCAGGCGGCGG - Intronic
1008598404 6:53065555-53065577 GGGGCGCGCTGGGGTGGCGGCGG - Intronic
1008630481 6:53359349-53359371 GAGTGCCGCGGGGGTGGCGGCGG - Intergenic
1010703233 6:79077566-79077588 CCGGGGCGCGGGGCGGGCGGGGG - Intronic
1011128947 6:84034500-84034522 ACGGGGCGCGGGGCGGGCGGGGG - Intronic
1011921741 6:92586330-92586352 GAGGCACGCAGGGGTGGCAGGGG - Intergenic
1013099727 6:106975718-106975740 GAGCCGCTCGGGGAGGGCGGTGG - Intergenic
1014098282 6:117482928-117482950 GAGGCGCCAGGGGCGGGCTGAGG + Intronic
1015149099 6:130019294-130019316 GAGGCGGGGGGCGCCGGCGGGGG + Intronic
1015226615 6:130864441-130864463 GCTGCGAGCGGGGCTGGAGGAGG + Intronic
1015244730 6:131063200-131063222 GAGGCAGGCGCGGCTGCCGGCGG - Exonic
1016523353 6:144971848-144971870 GAGGAGTGGGGGGCTGGAGGAGG - Intergenic
1016738959 6:147508603-147508625 GAGGGGCGCGCGACTGGCGCGGG - Intergenic
1016936318 6:149451323-149451345 GAGCCGCCCGGGGCTCTCGGTGG + Exonic
1017446276 6:154510043-154510065 GAGGTGCGCGGGCCTTGGGGGGG - Exonic
1018062796 6:160103662-160103684 GATGGGGGTGGGGCTGGCGGGGG + Intronic
1018091276 6:160348383-160348405 GAGGCGCGGGCTGCGGGCGGCGG + Exonic
1018172264 6:161152346-161152368 GAAGGGAGCGGGGCTGGCGCTGG + Intronic
1018876513 6:167826829-167826851 GCGGCGCGCACGGCGGGCGGCGG + Intergenic
1019298548 7:291316-291338 CGGGGGAGCGGGGCTGGCGGGGG - Intergenic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019343711 7:519909-519931 GAGGCGGGGGGGGGGGGCGGGGG - Intronic
1019395753 7:816829-816851 GCGGGGCGCGGGACGGGCGGGGG - Intronic
1019473533 7:1233363-1233385 GGGGGGCCCGGGGCTGGCGAAGG + Intronic
1019562207 7:1664717-1664739 GAGGGGCGCGGCGCTGGCAGCGG + Intergenic
1019632620 7:2057991-2058013 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632632 7:2058037-2058059 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632643 7:2058078-2058100 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632654 7:2058119-2058141 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632672 7:2058196-2058218 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632683 7:2058237-2058259 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632694 7:2058278-2058300 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632705 7:2058319-2058341 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632716 7:2058360-2058382 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019632823 7:2058791-2058813 GAGAGGCGCGGGGCTGGAGTGGG + Intronic
1019633037 7:2059627-2059649 GAGAGGCGCGGGGCTGGAGAGGG + Intronic
1019743669 7:2688141-2688163 GAGGCGGGCGGGACTGGGGCCGG - Intronic
1019828252 7:3301402-3301424 GAGGGGCGCGGCGCGGGCCGGGG - Intergenic
1020137423 7:5594697-5594719 GAGACGCGCGCGGCGGGCGAAGG - Intronic
1021450273 7:20778040-20778062 CAGGCGAGCGGGGCGGGGGGAGG + Intergenic
1021510503 7:21428003-21428025 GCGGCGCGCGGCGCGGGCGGCGG - Intergenic
1021668682 7:23013722-23013744 GCGGCGCGGGGCGCTGGGGGCGG - Intronic
1021716950 7:23469655-23469677 GGGGGGCGCGGGGCTGGGGGAGG - Intronic
1021969249 7:25950986-25951008 GAGGCTCCCGGGGTTGGGGGCGG + Intergenic
1021969353 7:25951364-25951386 CGGCCGCGCGGGGCTGGGGGCGG + Intergenic
1021998366 7:26201706-26201728 GCTGCGCGCGGGGCCGCCGGGGG - Intronic
1022003478 7:26246749-26246771 GAGGCGGGAGGGACTGGAGGAGG - Intergenic
1023921322 7:44632397-44632419 GAGGCGTGGGGGAGTGGCGGGGG - Intronic
1024213751 7:47228869-47228891 GAGGTGGGCGGGGCTGGAGGAGG - Intergenic
1024520948 7:50304035-50304057 GGTGCGCGCGGGGGTGGCGGCGG + Intergenic
1024707189 7:51973180-51973202 GTGGCGGGCGGGGCGGGTGGGGG - Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1026909404 7:74083736-74083758 GGGGCGCGGGCGGCCGGCGGCGG - Intronic
1027056468 7:75053106-75053128 GTGGTGCACGGGGCTGGGGGTGG + Intronic
1028684189 7:93574778-93574800 GAGGCGGGCGGGGGTGGGGCGGG - Intergenic
1029122495 7:98278284-98278306 GATGGGCGGGGGGCTGGGGGGGG + Intronic
1029139716 7:98401120-98401142 GAGGCGGGCGGGGCAGACGGGGG + Intergenic
1029372491 7:100158427-100158449 GCCGCGCGCGGAGCTGGCAGGGG - Exonic
1029483844 7:100827551-100827573 GAGGGGCGCGCGGGGGGCGGGGG + Intronic
1029730195 7:102433671-102433693 GCGGCGCGGGGGCCTGGCGCGGG + Intronic
1030983255 7:116210740-116210762 GGGGCGCTCGTGGCGGGCGGCGG + Intronic
1031586340 7:123535129-123535151 GAGGCGAGCGGGCGTGGAGGAGG + Intergenic
1032037301 7:128530648-128530670 GCGACGCGCGGGGCTGGGGCGGG + Intergenic
1033299935 7:140176664-140176686 GAGGCGCGGGCGGCCGGCGGCGG + Intronic
1033300073 7:140177274-140177296 GACACGCGCGGTGGTGGCGGTGG + Intergenic
1033306732 7:140230801-140230823 GGGGCGCGCGGGCCGGGCCGTGG + Intergenic
1033662050 7:143408869-143408891 GAGCCGGGCGGGCCGGGCGGGGG + Exonic
1034617899 7:152435459-152435481 GAGGGGCGCGGGGCCGGGGCCGG + Intronic
1035404287 7:158587901-158587923 GGGGCGAGCGGGGCTGGCCGGGG - Intergenic
1035404349 7:158588050-158588072 GGGACGCGCGGGGCGGGGGGCGG - Intergenic
1035747916 8:1974577-1974599 GCGGTGCTCGGGGCTCGCGGGGG - Intronic
1036125395 8:6057478-6057500 GAGCAGGGCGGGGCTGGCGCAGG - Intergenic
1037855280 8:22367199-22367221 GGGGCGAGCGGGGCGGGCCGGGG + Intergenic
1037967370 8:23145157-23145179 GTGGGGCGCAGGGCTGGCTGGGG + Intronic
1038147911 8:24914905-24914927 GGGGCGCGCGGCGCTGGCGCTGG - Intronic
1038540493 8:28386320-28386342 GAGGCGCGGGGGGCGGGCGGGGG - Intronic
1038599921 8:28929928-28929950 GCGGGGCGGGGGGCGGGCGGGGG - Intronic
1038828508 8:31033024-31033046 GCGGAGCGCGGGACGGGCGGCGG - Exonic
1039454239 8:37697078-37697100 GAGGCCTGCGGGGCGAGCGGGGG - Intronic
1039608385 8:38901104-38901126 GGGCCGCGCGGGGGAGGCGGGGG - Intergenic
1041262676 8:56035468-56035490 GAGGTGCGTGGGGCAGGCAGAGG + Intergenic
1041552640 8:59118947-59118969 GCGGCGGGCTGGGCTGGAGGTGG + Exonic
1042020893 8:64370700-64370722 GAGGTGCGCAGGGCAGGAGGAGG + Intergenic
1044821532 8:96158976-96158998 GAAGAGCTCGGGGCTGGGGGCGG + Intronic
1045432192 8:102124330-102124352 GAGGGGGGCGCGGCTGGCGACGG - Intronic
1047209883 8:122832725-122832747 GAGGCGGGAGGGACTGGAGGAGG + Intronic
1047529981 8:125665664-125665686 GAGGCGGGGAGGGCTGGAGGAGG + Intergenic
1047931133 8:129728927-129728949 GAGGCCCGAGGTGGTGGCGGTGG + Intergenic
1048214136 8:132480489-132480511 GCGGCGGGGGCGGCTGGCGGCGG - Exonic
1049548841 8:143247034-143247056 GAGGCGCGCGCCCCTCGCGGGGG - Intergenic
1049639301 8:143707386-143707408 GCGGCGCGCGGAGCGGGAGGCGG - Exonic
1049799071 8:144509444-144509466 GACGCGCGTGGGGCTGGCCAAGG + Exonic
1049883039 9:10993-11015 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1049883044 9:11022-11044 GAGGCGCGCCGCGCCGGCGCAGG + Intergenic
1050170430 9:2810100-2810122 GCGGTGGGGGGGGCTGGCGGGGG + Intronic
1052185757 9:25591633-25591655 GCGGGGCGGGGGGCTGGGGGAGG + Intergenic
1052754485 9:32526349-32526371 GCGGCGGGCGGGGTTCGCGGAGG + Intergenic
1053003381 9:34589906-34589928 GGGGCGCGCGGGGCCCGTGGCGG - Intronic
1054324142 9:63704701-63704723 GAGGCGCACGGCGCCGGCGCAGG + Intergenic
1054870607 9:70044424-70044446 GAGGCGCCCGGGGATGCTGGGGG + Intronic
1055530376 9:77177634-77177656 GAGGGGCGTGGGGAAGGCGGCGG + Exonic
1056190312 9:84178284-84178306 GAGGGGTGGGGGGCTGGGGGAGG - Intergenic
1056190963 9:84183312-84183334 GAGGGGTGGGGGGCTGGGGGAGG + Intergenic
1056588466 9:87944746-87944768 TAGGCCCGTGGGGCAGGCGGCGG + Intergenic
1057259670 9:93576680-93576702 GGGCCGCGCGGGGGCGGCGGGGG - Exonic
1057259814 9:93577115-93577137 GAGGCCCGCGGGCCGGGAGGTGG + Intronic
1058023714 9:100117604-100117626 GAGGTGGGCGGGGGGGGCGGGGG - Intronic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1059375244 9:113876208-113876230 GGGGCGCGCGGGGGGGGCGCCGG - Intergenic
1060477885 9:123999512-123999534 GAGGCGGGCGGGGACGGCCGGGG + Intergenic
1060478063 9:124000025-124000047 GCGGCGCGCGGGGCCGGGGAGGG - Intergenic
1060629394 9:125142993-125143015 GAGGCTAGGGGGGCTTGCGGGGG - Intronic
1060793074 9:126498615-126498637 GAGGCGCAGGGGGCAGGCGCTGG - Intronic
1060897007 9:127224864-127224886 GAACCCCGCGGGGCTGGCGCGGG + Intronic
1060897311 9:127225793-127225815 GAGGGGCGCGGGGGCCGCGGAGG - Intronic
1060942283 9:127549908-127549930 GAGGCTGGCGGGGCTGGGAGGGG - Intronic
1061009093 9:127944752-127944774 GAGCCGTGCTGGGCTGGTGGGGG - Intronic
1061050295 9:128191315-128191337 GGGGCGCGAGGAGGTGGCGGTGG - Intronic
1061975883 9:134067888-134067910 GCGGCGGGCGGCGCGGGCGGCGG - Intronic
1062048975 9:134437569-134437591 GAGGCCCGCGGGGATGGGAGGGG + Intronic
1062362257 9:136193609-136193631 GAGGGGAGCGGGGCCTGCGGAGG - Intergenic
1062460344 9:136660244-136660266 GAGGGGCGGGGGGTTGGCAGGGG - Intronic
1062461953 9:136665919-136665941 GCCGCGCGCGGAGCTGGGGGCGG + Intronic
1062624401 9:137436349-137436371 TATGGGCGCGGGGCTGGCGTGGG - Intronic
1062624419 9:137436401-137436423 TATGGGCGCGGGGCTGGCGTGGG - Intronic
1062711223 9:137976156-137976178 GAGGAGCAGGGGGCTGGCAGCGG + Intronic
1203773710 EBV:61611-61633 GCGGCTCGTGGGGCTCGCGGTGG + Intergenic
1203360418 Un_KI270442v1:216624-216646 GATGCGTGCTGGGCAGGCGGGGG + Intergenic
1185431341 X:13653-13675 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185431367 X:13717-13739 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185431447 X:13942-13964 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185432178 X:17625-17647 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185440631 X:226114-226136 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185440657 X:226178-226200 GAGGAGCGGGGGTCTGGGGGTGG - Intergenic
1185471604 X:387000-387022 GGGGCGCGCGTGGCTAGCGGCGG - Intergenic
1185778853 X:2828973-2828995 GAGGTGCGGGGGGCTGTAGGGGG + Exonic
1185836182 X:3347164-3347186 GAGGCGGGAGGGCGTGGCGGCGG - Intergenic
1186862748 X:13689386-13689408 GGTGCGCGCGGGGCTAGCGCGGG + Intronic
1187518161 X:19990965-19990987 GAGGCCCGAGGGGCCGGCGGCGG - Intergenic
1188242614 X:27809435-27809457 GGGGCGGGCGGGGTTGGGGGGGG - Intronic
1188242644 X:27809485-27809507 GGGGCGGGCGGGGCGGGGGGGGG - Intronic
1189288374 X:39867908-39867930 GAGGTGGACGGGGCTGGCGCTGG - Intergenic
1189325633 X:40109267-40109289 GGAGCGCGCGGGGGTGGGGGTGG - Intronic
1189333333 X:40155858-40155880 GGGGCGCGCGGAGCAGGAGGCGG + Intronic
1193321676 X:80130264-80130286 GAGGGGTGGGGGGCTGGGGGAGG - Intergenic
1195045541 X:101051666-101051688 GAGGCAGGCGGGGCTGGAGACGG - Exonic
1195212058 X:102659911-102659933 GAGGGGGGAGGGGCTGACGGTGG + Intergenic
1195625110 X:106999572-106999594 GAGCCGCGCGGGGCGGGCCGGGG - Intronic
1198215267 X:134549624-134549646 GAGGCGAGCGGCGCAGCCGGCGG + Intergenic
1199600907 X:149540556-149540578 GAGGAGGGCGGAGCTGGGGGAGG - Intronic
1199649481 X:149938873-149938895 GAGGAGGGCGGAGCTGGGGGAGG + Intergenic
1199736785 X:150693302-150693324 GCGGCGCGCGGGGCCGGCGCCGG - Intronic
1199772622 X:150984104-150984126 GAGGCGGGCGGAGCGGTCGGCGG + Intronic
1199772776 X:150984536-150984558 GGGACGCGCGGGGCCGGGGGCGG - Intronic
1200129028 X:153830980-153831002 GAGGGGAGCGGGGCCGGCTGCGG + Intergenic
1200218587 X:154379629-154379651 AAGGCGCGCGGGGAGGGCAGCGG - Intronic
1200229505 X:154437048-154437070 GAGGCGAGCCGGGGAGGCGGTGG + Exonic
1200267680 X:154654478-154654500 GAGGCGGGCAGGGGTGGGGGTGG + Intergenic
1200402757 X:156029119-156029141 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402762 X:156029148-156029170 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402767 X:156029177-156029199 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402772 X:156029206-156029228 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402777 X:156029235-156029257 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402782 X:156029264-156029286 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402787 X:156029293-156029315 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic
1200402792 X:156029322-156029344 GAGGCGCGCCGCGCCGGCGCAGG - Intergenic