ID: 1089209457

View in Genome Browser
Species Human (GRCh38)
Location 11:116790557-116790579
Sequence GAGGCGCGCGGGGCTGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 938
Summary {0: 1, 1: 0, 2: 6, 3: 99, 4: 832}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089209447_1089209457 4 Left 1089209447 11:116790530-116790552 CCGGGAGAGCACCTGCACGCAGC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832
1089209449_1089209457 -7 Left 1089209449 11:116790541-116790563 CCTGCACGCAGCGACTGAGGCGC 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832
1089209443_1089209457 26 Left 1089209443 11:116790508-116790530 CCTTGGCCTTGAGCGTGAGCTTC 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832
1089209446_1089209457 20 Left 1089209446 11:116790514-116790536 CCTTGAGCGTGAGCTTCCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG 0: 1
1: 0
2: 6
3: 99
4: 832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089209457 Original CRISPR GAGGCGCGCGGGGCTGGCGG GGG Exonic