ID: 1089209476

View in Genome Browser
Species Human (GRCh38)
Location 11:116790675-116790697
Sequence AGCCGCGTGGTGCACCACAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089209476_1089209483 29 Left 1089209476 11:116790675-116790697 CCGGTGTGGTGCACCACGCGGCT 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1089209483 11:116790727-116790749 CGTCCACGCCCCCCAGCAACTGG 0: 1
1: 0
2: 0
3: 3
4: 99
1089209476_1089209484 30 Left 1089209476 11:116790675-116790697 CCGGTGTGGTGCACCACGCGGCT 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1089209484 11:116790728-116790750 GTCCACGCCCCCCAGCAACTGGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089209476 Original CRISPR AGCCGCGTGGTGCACCACAC CGG (reversed) Exonic
900407444 1:2498807-2498829 ACCCGCGTGGTGGACGACAACGG + Exonic
900628913 1:3623614-3623636 AGACGCATGTTGCACCACAGCGG - Intergenic
903111877 1:21142361-21142383 AGGCACATGGTGCACCACACTGG - Intronic
908816930 1:68044056-68044078 AGCTGCGGGGTACACCACAGGGG - Intergenic
910308964 1:85801368-85801390 ATCCTAGTGGTGCATCACACTGG - Intronic
913516765 1:119611775-119611797 CCTCACGTGGTGCACCACACGGG + Intergenic
923338026 1:232986595-232986617 GGCCACCTGCTGCACCACACAGG - Intronic
1082160846 11:48886180-48886202 AGCCGCGTTCTCCACCACAGTGG - Intergenic
1082161520 11:48894226-48894248 AGCCGCGTTCTCCACCACAGTGG + Intergenic
1088881185 11:113974911-113974933 AGCAGCGTGGTGCACCTCCCAGG + Intronic
1089209476 11:116790675-116790697 AGCCGCGTGGTGCACCACACCGG - Exonic
1100169115 12:91952994-91953016 AGCTGCCTGAGGCACCACACAGG - Intergenic
1108058090 13:46505178-46505200 AGCTGCGTGTTGCACTACACCGG + Intergenic
1108582505 13:51839152-51839174 AGCGGCCTGGAGCACCACCCCGG + Intergenic
1111006712 13:82258335-82258357 AGGAGTGTGGTGCACCGCACGGG + Intergenic
1118192637 14:63594462-63594484 AGCCCCCTGATGCACCACCCAGG + Intergenic
1121566023 14:94909871-94909893 AGCCGCCTGGTGGAGCACATTGG - Intergenic
1122326325 14:100882790-100882812 AGCCGAGTGGTTCACAAAACTGG - Exonic
1122806680 14:104263346-104263368 AGCCTCCTGCTGCACCAGACAGG + Intergenic
1127965970 15:63923182-63923204 AGCCACGTCTTCCACCACACAGG + Intronic
1128501520 15:68230110-68230132 ACCCGCGTGGTGCAGCACGTGGG + Intronic
1128501521 15:68230111-68230133 ACCCACGTGCTGCACCACGCGGG - Intronic
1134095390 16:11415324-11415346 AGCCGTGAGCTGCACCCCACGGG - Intronic
1142190541 16:88715286-88715308 GGCCACCTGGTACACCACACTGG + Exonic
1142603380 17:1068398-1068420 AGCCTGGTGGTGTAACACACTGG + Intronic
1142950258 17:3472380-3472402 AGCCGCGTGGTGTGCGACCCTGG + Intronic
1147962613 17:44177261-44177283 AGCCGCGGGCTCCCCCACACAGG - Intronic
1152282450 17:79393235-79393257 AGCCGCCTGCTGCAGCACAGGGG + Intronic
1160548936 18:79680770-79680792 AGCCCCGTGGTTGACCACAGTGG + Intronic
1161421934 19:4180820-4180842 ACCCGTGTGGAACACCACACTGG + Exonic
1165103839 19:33457038-33457060 AGCCTCGTGTAGCCCCACACGGG + Intronic
1168614466 19:57826693-57826715 ACCTGCGTGGTGCACTACACCGG - Intronic
925731161 2:6920162-6920184 GGCCACGTGGTGGACCACAGGGG - Intronic
930198495 2:48530789-48530811 AGCCGCGGGGGCCACCACACTGG + Exonic
932557617 2:72839287-72839309 AGCTGCGTTCTGCACCACAATGG - Intergenic
946939110 2:224752516-224752538 AGCAGTGTGGAGCACCACTCTGG - Intergenic
1168904560 20:1392833-1392855 ACCTGCGTGGTGCACTACACCGG - Exonic
1175986053 20:62764640-62764662 AGCCTCTGGGTGCACAACACAGG - Intergenic
1184278882 22:43426129-43426151 AGCAGGGTGGGGCACCTCACGGG - Intronic
961743159 3:129046492-129046514 AACCCGGTGGTGCCCCACACTGG - Intergenic
963290316 3:143480632-143480654 AGCTGCGTGGGGCACCACCTGGG + Intronic
963778499 3:149464029-149464051 ACCTGCGTGATGCACTACACCGG - Intergenic
971390703 4:26182774-26182796 AGCCGGGTGGTGGCTCACACCGG - Intronic
985961667 5:3307342-3307364 AGCCCAGTGGTGCAGCCCACAGG + Intergenic
1009396999 6:63211620-63211642 ACCTGCGTGATGCACTACACCGG + Exonic
1019604598 7:1902090-1902112 AGCCCCCTGGTACACCCCACTGG - Intronic
1027190894 7:75994840-75994862 AGCCGCGTGGTGCAGCCAGCAGG + Intergenic
1027867253 7:83663400-83663422 AGCTGTGAGGTGCACAACACAGG + Intergenic
1034547291 7:151797245-151797267 CGCCGCCTGGTGCTCCCCACCGG + Intronic
1036123956 8:6046385-6046407 AGCCACCTGGTGCTCCAGACTGG + Intergenic
1049607123 8:143534884-143534906 AGCCGGGTGTTGCAGCACAGTGG - Intronic