ID: 1089211801

View in Genome Browser
Species Human (GRCh38)
Location 11:116809007-116809029
Sequence TGGGGCATTTCTCGACCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089211801_1089211809 26 Left 1089211801 11:116809007-116809029 CCATCAGGTCGAGAAATGCCCCA No data
Right 1089211809 11:116809056-116809078 CTGCCGGTGGTGCAACAGCTGGG No data
1089211801_1089211805 10 Left 1089211801 11:116809007-116809029 CCATCAGGTCGAGAAATGCCCCA No data
Right 1089211805 11:116809040-116809062 TTTGTGTCAAAAATGCCTGCCGG No data
1089211801_1089211808 25 Left 1089211801 11:116809007-116809029 CCATCAGGTCGAGAAATGCCCCA No data
Right 1089211808 11:116809055-116809077 CCTGCCGGTGGTGCAACAGCTGG No data
1089211801_1089211812 30 Left 1089211801 11:116809007-116809029 CCATCAGGTCGAGAAATGCCCCA No data
Right 1089211812 11:116809060-116809082 CGGTGGTGCAACAGCTGGGTGGG No data
1089211801_1089211806 13 Left 1089211801 11:116809007-116809029 CCATCAGGTCGAGAAATGCCCCA No data
Right 1089211806 11:116809043-116809065 GTGTCAAAAATGCCTGCCGGTGG No data
1089211801_1089211811 29 Left 1089211801 11:116809007-116809029 CCATCAGGTCGAGAAATGCCCCA No data
Right 1089211811 11:116809059-116809081 CCGGTGGTGCAACAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089211801 Original CRISPR TGGGGCATTTCTCGACCTGA TGG (reversed) Intergenic