ID: 1089213661

View in Genome Browser
Species Human (GRCh38)
Location 11:116822688-116822710
Sequence GAGATGTTCCACGGCCTCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089213657_1089213661 15 Left 1089213657 11:116822650-116822672 CCCTCTTACTTGAGTTGCTGGGT 0: 1
1: 0
2: 0
3: 6
4: 140
Right 1089213661 11:116822688-116822710 GAGATGTTCCACGGCCTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 118
1089213658_1089213661 14 Left 1089213658 11:116822651-116822673 CCTCTTACTTGAGTTGCTGGGTG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1089213661 11:116822688-116822710 GAGATGTTCCACGGCCTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 118
1089213654_1089213661 29 Left 1089213654 11:116822636-116822658 CCGCACACTGTAGTCCCTCTTAC 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1089213661 11:116822688-116822710 GAGATGTTCCACGGCCTCCTTGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089213661 Original CRISPR GAGATGTTCCACGGCCTCCT TGG Exonic
902107165 1:14047397-14047419 GTGCTGTTCCATGGGCTCCTGGG - Intergenic
902488648 1:16764623-16764645 GACTTGTTCCCCGGCCTCTTTGG - Intronic
902492158 1:16790676-16790698 GAGATTTTTCAAGGCCTCCTGGG - Intronic
904365453 1:30008183-30008205 GAGGGGTCCCACTGCCTCCTTGG + Intergenic
904912457 1:33945534-33945556 GGGATGTTTCAGGGCCTCCTAGG + Intronic
906136866 1:43506144-43506166 GAGATGAACCAAGGCCTCCTAGG - Intergenic
906137317 1:43508481-43508503 GAGATGAACCAAGGCCTCCTAGG - Intergenic
906580840 1:46934197-46934219 GAGGAGATCCACAGCCTCCTGGG - Exonic
906602884 1:47144697-47144719 GAGGAGATCCATGGCCTCCTGGG + Exonic
911856824 1:102888583-102888605 GTGGTCTTCCAGGGCCTCCTGGG - Exonic
914714261 1:150241127-150241149 GAGATGTTGCAAGGCATCATAGG - Intergenic
915636434 1:157190165-157190187 GAGATGCACCAAGGCCTCCAGGG + Intergenic
915638852 1:157205379-157205401 GAGATTTTCCACGACCTCTGTGG + Intergenic
917277916 1:173350623-173350645 GAGTTGCTCCAAGGTCTCCTAGG - Intergenic
923501105 1:234565401-234565423 GAGAGCTTCCACTGCCTCCTAGG + Intergenic
923528289 1:234791861-234791883 GAGATTTTTCAAGGCCTCCTGGG + Intergenic
1063124567 10:3127292-3127314 GCGCTGTTCCACAGCCCCCTGGG + Intronic
1063251618 10:4280873-4280895 GAGTTGTTCCTCATCCTCCTGGG - Intergenic
1065319307 10:24494383-24494405 GTGAACTTCCACGGCCTTCTAGG + Intronic
1066124088 10:32321910-32321932 GAGATGATCAACAGCATCCTAGG + Intronic
1069678822 10:70269230-70269252 GTGATGTACCTCTGCCTCCTGGG + Intronic
1070248479 10:74753390-74753412 GAGATGTGGCACGGCCACCTGGG - Intergenic
1071366164 10:84902601-84902623 GTGATGTTTCCTGGCCTCCTAGG + Intergenic
1071514467 10:86288040-86288062 GAGTTGTACCATTGCCTCCTGGG + Intronic
1073214005 10:101826661-101826683 GAAATTTTCCACACCCTCCTCGG - Intronic
1077424854 11:2470457-2470479 GAGATGTTCTTCCGCCTCCCTGG - Intronic
1077564077 11:3285255-3285277 AAAATGTTCCACAGCCTCCACGG + Intergenic
1077569967 11:3331072-3331094 AAAATGTTCCACAGCCTCCACGG + Intergenic
1078550362 11:12276000-12276022 GAGATGCTCTTCGGCCTCTTGGG - Intergenic
1081545785 11:44070693-44070715 GTGATGTTGCAGGGTCTCCTGGG + Intronic
1083799004 11:65035544-65035566 GAGGAGATCCAGGGCCTCCTGGG - Exonic
1084606613 11:70176013-70176035 AAGCTGTACCACGGCCACCTTGG - Intronic
1089213661 11:116822688-116822710 GAGATGTTCCACGGCCTCCTTGG + Exonic
1092474182 12:8805391-8805413 GAGATGTTCCTTGGGCTGCTTGG - Intergenic
1104268976 12:127264950-127264972 GAGAGCTTCCATGCCCTCCTTGG + Intergenic
1106472232 13:30066730-30066752 CAGATGTTCCAGGGCCCTCTGGG - Intergenic
1106572810 13:30943198-30943220 GAGATATTTCACCTCCTCCTTGG + Intronic
1107440914 13:40426326-40426348 GTGAACTTCCACGGCTTCCTAGG - Intergenic
1108789670 13:53952539-53952561 GGAATGTTCCACGGCCATCTAGG - Intergenic
1111839613 13:93433717-93433739 GAGATTTTCCAGGGGCTGCTGGG + Intronic
1118310054 14:64685543-64685565 CAGATGTTCCACTGTCTCCATGG - Intergenic
1121665637 14:95670095-95670117 GAGATGATACAGGGGCTCCTGGG - Intergenic
1122256729 14:100483618-100483640 GAAATGTTCCATGACCTCCCTGG + Intronic
1123581082 15:21715355-21715377 GAAACCTTCCAAGGCCTCCTGGG - Intergenic
1123617731 15:22157978-22158000 GAAACCTTCCAAGGCCTCCTGGG - Intergenic
1126530420 15:49704213-49704235 GAGATGTTCCTTGGGCTGCTTGG + Intergenic
1129836721 15:78712817-78712839 GACATGTTCCAAGCCCACCTCGG - Intronic
1137718481 16:50613219-50613241 CAGGTATCCCACGGCCTCCTCGG - Intronic
1141253929 16:82383500-82383522 GAGATGTCCCAGAGCCACCTCGG - Intergenic
1142302138 16:89265056-89265078 CAGATGCTGCACGGTCTCCTGGG + Intergenic
1143351704 17:6292773-6292795 GATTTGTTCCAGGACCTCCTTGG + Intergenic
1145814057 17:27782844-27782866 GAGCTGTGCCCAGGCCTCCTGGG - Intronic
1147465379 17:40607032-40607054 GAGGTTTTCCCCGGCCTCTTAGG + Intergenic
1148448649 17:47758195-47758217 GTGATGTTCAAGGGCCTCCTTGG - Intergenic
1148731557 17:49839873-49839895 CACACGTTCCAGGGCCTCCTGGG - Exonic
1149537062 17:57441225-57441247 GAGAGGTTCCACTCCCTCCAAGG + Intronic
1149569235 17:57660720-57660742 ATGATGTTCCCCGGCCCCCTGGG - Intronic
1155521258 18:26671345-26671367 GAGATAGTCCAAGGCCTCCCTGG + Intergenic
1156188527 18:34691051-34691073 GTGATGCTCCACTGCCTCTTAGG + Intronic
1158461487 18:57649732-57649754 GAGAAGTTCCACGGCCCCTAAGG + Intronic
1161853757 19:6752627-6752649 GAGAAGTTCCAGCGCGTCCTCGG - Exonic
1162858990 19:13491417-13491439 GAGAGTTTCCATGTCCTCCTGGG + Intronic
1164400251 19:27897229-27897251 GAGATGCTGCACGTCCTGCTAGG + Intergenic
1164869047 19:31628157-31628179 AATATGTTCCACAGCCTCATTGG + Intergenic
1164915460 19:32048197-32048219 GGGATGTTCCACAGCCTCCCAGG + Intergenic
1165417697 19:35704843-35704865 GAGTTGGTCCACGGCCCCCGAGG + Intronic
1165432551 19:35780917-35780939 CAGCTGTGCCACGGCCTCGTGGG + Exonic
1166920037 19:46222955-46222977 GGGAGCTTCCATGGCCTCCTTGG + Intergenic
1167052262 19:47086485-47086507 GCGATCCTCCACGGCTTCCTCGG + Exonic
1168666196 19:58206987-58207009 GAGCTGGTCCAGGGCCTCCCGGG - Exonic
925236109 2:2279037-2279059 GAGATGGTCCAGGGCCTCCCAGG - Intronic
929565767 2:42983616-42983638 GAGCTGTGCCACGACCACCTTGG + Intergenic
931472909 2:62557343-62557365 CAGATGTTCCTGGGCCTCATAGG - Intergenic
931643400 2:64400893-64400915 GAAATGGTCCAAGGCCACCTGGG + Intergenic
934675522 2:96247063-96247085 TTGATGTTCCAGGCCCTCCTGGG + Intergenic
935512941 2:103998594-103998616 AAGATGTTCCAGGGAATCCTAGG + Intergenic
943449910 2:188034022-188034044 GAGATGTTCCCTGGCCTGGTCGG - Intergenic
945296544 2:208176527-208176549 GGGATGTTTCACAGCATCCTTGG - Intronic
1168877414 20:1181110-1181132 GAGATGTACTACGCCCGCCTAGG - Exonic
1168943550 20:1733008-1733030 GAGATGTTCCTTGGGCTGCTTGG + Intergenic
1171102658 20:22400102-22400124 GAGATGGCCCATGGCCTGCTTGG + Intergenic
1172614955 20:36277252-36277274 GAGTTCTTCCAGGGCCTCCCAGG - Intergenic
1174510362 20:51046628-51046650 GAAATGTTTCAGGGCCTTCTAGG + Intergenic
1176362394 21:6008767-6008789 GAGATCTTCCAGGAGCTCCTGGG - Intergenic
1179761124 21:43529778-43529800 GAGATCTTCCAGGAGCTCCTGGG + Exonic
1182776709 22:32836835-32836857 TAGATGTACCAGGGTCTCCTTGG + Intronic
952891837 3:38048183-38048205 GAGATGTTCCAGGCCATCTTGGG + Intronic
955941758 3:64152661-64152683 GATATCTTCCATAGCCTCCTTGG - Intronic
956213257 3:66823748-66823770 GAAAGTTTCCACGGCCTCCCTGG + Intergenic
956798663 3:72738146-72738168 GAGATCTTCCATGGCTCCCTGGG + Intergenic
961880733 3:130059669-130059691 GAGATGTTCCTTGGGCTGCTGGG - Intergenic
965761308 3:172079900-172079922 GAGATGTTACGCAGCCTCATAGG - Intronic
967001082 3:185335583-185335605 GATTGGTTCCACGACCTCCTAGG + Intronic
968542529 4:1175361-1175383 GGGCTGTTCCGCAGCCTCCTTGG - Intronic
971226847 4:24762156-24762178 GTGATTTTCCACTGCCTTCTAGG + Intergenic
972833755 4:42843721-42843743 GAGATGTACCACAGCATCATAGG + Intergenic
981482933 4:145256438-145256460 GAGATGTTCCTTGGGCTCATTGG + Intergenic
985519204 5:363420-363442 TAGAGGTACCACGGCCACCTAGG - Intronic
999322690 5:150624990-150625012 CAGATGTGCCACCTCCTCCTGGG - Intronic
1002429025 5:179192370-179192392 CAGATGTTCCAGCGCCTCTTGGG + Intronic
1002913447 6:1509150-1509172 GAGATCTTCCACGGCCTTTTTGG + Intergenic
1011034048 6:82954098-82954120 AAGATGTTCCCCGGCCTTATTGG + Intronic
1014102744 6:117529995-117530017 GGCATGTCCCAGGGCCTCCTTGG - Intronic
1014248583 6:119093635-119093657 AAGATGTTACTCGTCCTCCTTGG - Intronic
1015609848 6:135004914-135004936 GAGTTCTTCCAAGGCCTCCTAGG - Intronic
1018819125 6:167359351-167359373 GAGATGTTCCACCGTCCCGTCGG + Intronic
1019128735 6:169858792-169858814 GAGCTGTGCCAGGGCCTGCTGGG + Intergenic
1022507561 7:30916183-30916205 GAGAGGGGACACGGCCTCCTGGG + Intronic
1023830449 7:44036262-44036284 GACATGGGCCATGGCCTCCTGGG + Intergenic
1025210593 7:57017837-57017859 GAGATCTGCCACTGCATCCTGGG - Intergenic
1025661363 7:63559010-63559032 GAGATCTGCCACTGCATCCTGGG + Intergenic
1029740772 7:102490556-102490578 GACATGGGCCATGGCCTCCTGGG + Intronic
1029758766 7:102589729-102589751 GACATGGGCCATGGCCTCCTGGG + Intronic
1033625360 7:143105608-143105630 GAGATGTTCCTTGGGCTGCTTGG - Intergenic
1034911846 7:155003482-155003504 GAGCGGTTCTGCGGCCTCCTCGG + Intergenic
1036168080 8:6456599-6456621 GAGAGGTACCACGGCTTCCCTGG - Intronic
1037823665 8:22147977-22147999 GTGATGATGCACGTCCTCCTGGG + Exonic
1041462582 8:58128307-58128329 TCAGTGTTCCACGGCCTCCTAGG + Intronic
1041719420 8:60962819-60962841 CAGATGATCCACCGCCCCCTTGG - Intergenic
1049512641 8:143037327-143037349 GAGCTGTACCCCGGCCACCTTGG + Intergenic
1050177232 9:2880926-2880948 GCAATGCTCCATGGCCTCCTTGG - Intergenic
1051364553 9:16312217-16312239 GAGATGTAGTACGGCCACCTCGG - Intergenic
1055648410 9:78382721-78382743 GAGATGTTCACCAGCATCCTTGG - Intergenic
1059459899 9:114423071-114423093 GAGATGTGGCCCTGCCTCCTGGG - Intronic
1060845922 9:126837524-126837546 GGGATGTGCTGCGGCCTCCTGGG + Exonic
1062342242 9:136098921-136098943 GAGAGGCTCCAGGTCCTCCTGGG - Intergenic
1188419257 X:29976056-29976078 GAGATGTTCCTCGGGCTGGTGGG - Intergenic
1189620786 X:42835094-42835116 GAAATATTCCACTGCATCCTGGG - Intergenic
1195222650 X:102761417-102761439 GGGATGTTCAGCAGCCTCCTTGG - Intergenic
1197728626 X:129792733-129792755 GGCATGCCCCACGGCCTCCTCGG - Exonic
1200751217 Y:6945702-6945724 GTGATGTTCCACAGGTTCCTTGG + Intronic